AT5G12070

rejection of self pollen

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0000577
Physical Location & Seq
Reverse (-)
3896950 .. 3897408
459 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G12070.1

Sequence Viewer

Length: 459 bp
ATGACAACCATGCTAAAAACACAAGTTCATGTGGTGGTAATATATCTACTCATCCAAATAGCTTTCTCACAAGTGAAACCCGGTTCTGATCTAAAGTGGTCTACTTTAAAATCAGTGGTGACGATCACAAACCGCCTTGGCGATGGTTCGACCTTAAAACTTCATTGTAAGTCCGCAGATGACGATCTTGGCCTCAAAATCCTCGCTCCGAATGGTTCTTGGTCGTTTAAATTTAGACCAAGTATTGTTCCTGGAGTGACACTTTTCTTTTGTCATTTCACATGGCCTGGACAATCAAAATGGTTTAACATTTACGATGATGACAGAGATGGTGTTCGTATGGGTATTCCATGCATCTACTGTATCTGGGATATAGGCAAATATGGGCCATGCAGGTTTAGTGAAATAGATGATGCATTTAATATTTGTTATGATTGGAATGGAAACCGAAGATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

152

Amino Acids

17.32

Weight (kDa)

8.54

Isoelectric Point (pI)

23.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 40 - 146 2.2e-29 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000577)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G16960 AT3G16970 AT3G17080 AT4G16195 AT5G12060 AT5G12070
fragaria_vesca FvH4_2g16811 FvH4_4g02030 FvH4_4g02050 FvH4_4g02160 FvH4_4g05620
malus_domestica MD04G1130600.v1.1 MD07G1006200.v1.1 MD07G1270000.v1.1 MD09G1134100.v1.1 MD09G1134200.v1.1 MD10G1085700.v1.1 MD17G1052500.v1.1 MD17G1052600.v1.1 MD17G1052700.v1.1 MD17G1123000.v1.1
prunus_persica Prupe.1G026600_v2.0.a1 Prupe.1G049500_v2.0.a1 Prupe.1G055500_v2.0.a1 Prupe.1G055600_v2.0.a1 Prupe.1G057000_v2.0.a1 Prupe.1G057100_v2.0.a1 Prupe.1G057200_v2.0.a1 Prupe.1G057300_v2.0.a1 Prupe.1G058100_v2.0.a1 Prupe.8G012700_v2.0.a1
pyrus_communis pycom17g05060 pycom17g11360
rosa_chinensis RchiOBHm_Chr3g0496401 RchiOBHm_Chr4g0389011 RchiOBHm_Chr4g0389231 RchiOBHm_Chr4g0389421 RchiOBHm_Chr4g0396771 RchiOBHm_Chr4g0396781 RchiOBHm_Chr4g0396791 RchiOBHm_Chr4g0399631 RchiOBHm_Chr4g0399641 RchiOBHm_Chr5g0071851 RchiOBHm_Chr6g0268511
rosa_laevigata RLG00000009249 RLG00000009256 RLG00000009505 RLG00000009983 RLG00000009984 RLG00000013253
rosa_multiflora Rmu_sc0000487.1_g000011 Rmu_sc0002404.1_g000026
rosa_roxburghii Rroxscaffold_5G00335430 Rroxscaffold_5G00341610
rosa_rugosa Rorug03G0282200 Rorug03G0347600 Rorug04G0017800 Rorug04G0017800 Rorug05G0227600 Rorug06G0042400 Rorug06G0042500
rosa_samantha Rh3AG328900 Rh4AG027600 Rh4BG093100 Rh4CG029700 Rh4CG077600 Rh4CG077800 Rh4CG104100 Rh4CG104200 Rh4DG020800 Rh4DG021100 Rh4DG021200 Rh4DG067000 Rh4DG067100 Rh6AG162000 Rh6BG166300
rosa_wichuraiana Rw4G002000 Rw4G005780 Rw4G005790 Rw4G007880 Rw6G013990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 384
AccI GTMKAC 1 cut(s) 101
AciI CCGC 2 cut(s) 133, 174
AcsI RAATTY 1 cut(s) 230
AjnI CCWGG 2 cut(s) 250, 286
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
AoxI GGCC 3 cut(s) 190, 284, 386
ApoI RAATTY 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 386
AsuC2I CCSGG 1 cut(s) 81
AsuHPI GGTGA 1 cut(s) 130
BccI CCATC 2 cut(s) 137, 323
BciT130I CCWGG 2 cut(s) 252, 288
BcnI CCSGG 1 cut(s) 81
BfuAI ACCTGC 1 cut(s) 384
Bme1390I CCNGG 3 cut(s) 81, 252, 288
BmgT120I GGNCC 1 cut(s) 386
BmrFI CCNGG 3 cut(s) 81, 252, 288
BmsI GCATC 2 cut(s) 363, 403
BpmI CTGGAG 1 cut(s) 273
BpuMI CCSGG 1 cut(s) 81
BsaBI GATNNNNATC 1 cut(s) 183
BsaJI CCNNGG 1 cut(s) 136
Bse8I GATNNNNATC 1 cut(s) 183
BseBI CCWGG 2 cut(s) 252, 288
BseDI CCNNGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 51
BseJI GATNNNNATC 1 cut(s) 183
BshFI GGCC 3 cut(s) 192, 286, 388
BsiSI CCGG 1 cut(s) 81
BsnI GGCC 3 cut(s) 192, 286, 388
Bsp143I GATC 4 cut(s) 88, 123, 184, 452
BspACI CCGC 2 cut(s) 133, 174
BspANI GGCC 3 cut(s) 192, 286, 388
BspMI ACCTGC 1 cut(s) 384
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 4 cut(s) 88, 123, 184, 452
BssT1I CCWWGG 1 cut(s) 136
Bst2UI CCWGG 2 cut(s) 252, 288
Bst4CI ACNGT 1 cut(s) 362
BstF5I GGATG 1 cut(s) 51
BstKTI GATC 4 cut(s) 91, 126, 187, 455
BstMBI GATC 4 cut(s) 88, 123, 184, 452
BstNI CCWGG 2 cut(s) 252, 288
BstSCI CCNGG 3 cut(s) 79, 250, 286
BsuRI GGCC 3 cut(s) 192, 286, 388
BtgZI GCGATG 1 cut(s) 156
BtsCI GGATG 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 120
BveI ACCTGC 1 cut(s) 384
Cfr13I GGNCC 1 cut(s) 386
CviAII CATG 5 cut(s) 10, 29, 282, 351, 390
CviJI RGCY 4 cut(s) 62, 192, 286, 388
CviKI_1 RGCY 4 cut(s) 62, 192, 286, 388
DpnI GATC 4 cut(s) 90, 125, 186, 454
DpnII GATC 4 cut(s) 88, 123, 184, 452
DraI TTTAAA 2 cut(s) 108, 229
Eco130I CCWWGG 1 cut(s) 136
EcoRII CCWGG 2 cut(s) 250, 286
EcoT14I CCWWGG 1 cut(s) 136
EcoT22I ATGCAT 2 cut(s) 356, 418
ErhI CCWWGG 1 cut(s) 136
FaeI CATG 5 cut(s) 13, 32, 285, 354, 393
FatI CATG 5 cut(s) 9, 28, 281, 350, 389
FblI GTMKAC 1 cut(s) 101
FokI GGATG 1 cut(s) 38
GsuI CTGGAG 1 cut(s) 273
HaeIII GGCC 3 cut(s) 192, 286, 388
HapII CCGG 1 cut(s) 81
Hin1II CATG 5 cut(s) 13, 32, 285, 354, 393
HpaII CCGG 1 cut(s) 81
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 102
Hpy188I TCNGA 2 cut(s) 88, 210
Hpy8I GTNNAC 1 cut(s) 102
HpyCH4III ACNGT 1 cut(s) 362
HpyCH4V TGCA 3 cut(s) 354, 393, 416
Hsp92II CATG 5 cut(s) 13, 32, 285, 354, 393
Kzo9I GATC 4 cut(s) 88, 123, 184, 452
LmnI GCTCC 1 cut(s) 211
LpnPI CCDG 7 cut(s) 94, 237, 264, 273, 300, 352, 379
LweI GCATC 2 cut(s) 363, 403
MaeIII GTNAC 2 cut(s) 118, 256
MalI GATC 4 cut(s) 90, 125, 186, 454
MboI GATC 4 cut(s) 88, 123, 184, 452
MluCI AATT 1 cut(s) 230
MnlI CCTC 2 cut(s) 203, 212
Mph1103I ATGCAT 2 cut(s) 356, 418
MseI TTAA 5 cut(s) 107, 155, 228, 306, 420
MspI CCGG 1 cut(s) 81
MspR9I CCNGG 3 cut(s) 81, 252, 288
MvaI CCWGG 2 cut(s) 252, 288
NciI CCSGG 1 cut(s) 81
NdeII GATC 4 cut(s) 88, 123, 184, 452
NlaIII CATG 5 cut(s) 13, 32, 285, 354, 393
NmuCI GTSAC 2 cut(s) 118, 256
NsiI ATGCAT 2 cut(s) 356, 418
PfoI TCCNGGA 1 cut(s) 250
Psp6I CCWGG 2 cut(s) 250, 286
PspGI CCWGG 2 cut(s) 250, 286
PspPI GGNCC 1 cut(s) 386
SaqAI TTAA 5 cut(s) 107, 155, 228, 306, 420
Sau3AI GATC 4 cut(s) 88, 123, 184, 452
Sau96I GGNCC 1 cut(s) 386
ScrFI CCNGG 3 cut(s) 81, 252, 288
SetI ASST 3 cut(s) 64, 155, 398
SfaNI GCATC 2 cut(s) 363, 403
Sse9I AATT 1 cut(s) 230
SsiI CCGC 2 cut(s) 133, 174
SspI AATATT 1 cut(s) 424
StyD4I CCNGG 3 cut(s) 79, 250, 286
StyI CCWWGG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 362
TaqI TCGA 1 cut(s) 149
TasI AATT 1 cut(s) 230
Tru1I TTAA 5 cut(s) 107, 155, 228, 306, 420
Tru9I TTAA 5 cut(s) 107, 155, 228, 306, 420
TscAI CASTG 1 cut(s) 120
TseFI GTSAC 2 cut(s) 118, 256
Tsp45I GTSAC 2 cut(s) 118, 256
TspDTI ATGAA 2 cut(s) 17, 152
TspRI CASTG 1 cut(s) 120
XapI RAATTY 1 cut(s) 230
XmiI GTMKAC 1 cut(s) 101
Zsp2I ATGCAT 2 cut(s) 356, 418
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.