Rh4DG020800

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
3245945 .. 3246840
896 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG020800.1

Sequence Viewer

Length: 399 bp
ATGGCTTCGTTCGTTGGAAGAACAGTGAAGCTAATATTGCTTTTGCTATTCTTAACAACCACATGTGATGCTAAAACATATGTTAGAATCACTAATGATTTGGGCGGAGGAATGAATCTCACCTTTCACTGTAGATCCGCAGATGATGATCTCGGCGTCAAAGTGCTTCTTCCCCAACAATACTATGAGTTCAGTTTCAAACCTACCTTGATAGGCCGAACAGACTTCTATTGCAGTTTTCAATGGATTGGTTCATTTAAATGGTTTGATGTATATGTTGATGGAAGAGACTACTGCTATGAGTGTTGGTGGAGTATAAAATCTTCTGGCAATGGCCCTTGTAGGCTTAACTTCAAAACTGGCCAGTATGATGATTGTTTGCCGTGGAACAAAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

15.31

Weight (kDa)

7.51

Isoelectric Point (pI)

24.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 28 - 129 1.5e-24 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000577)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G16960 AT3G16970 AT3G17080 AT4G16195 AT5G12060 AT5G12070
fragaria_vesca FvH4_2g16811 FvH4_4g02030 FvH4_4g02050 FvH4_4g02160 FvH4_4g05620
malus_domestica MD04G1130600.v1.1 MD07G1006200.v1.1 MD07G1270000.v1.1 MD09G1134100.v1.1 MD09G1134200.v1.1 MD10G1085700.v1.1 MD17G1052500.v1.1 MD17G1052600.v1.1 MD17G1052700.v1.1 MD17G1123000.v1.1
prunus_persica Prupe.1G026600_v2.0.a1 Prupe.1G049500_v2.0.a1 Prupe.1G055500_v2.0.a1 Prupe.1G055600_v2.0.a1 Prupe.1G057000_v2.0.a1 Prupe.1G057100_v2.0.a1 Prupe.1G057200_v2.0.a1 Prupe.1G057300_v2.0.a1 Prupe.1G058100_v2.0.a1 Prupe.8G012700_v2.0.a1
pyrus_communis pycom17g05060 pycom17g11360
rosa_chinensis RchiOBHm_Chr3g0496401 RchiOBHm_Chr4g0389011 RchiOBHm_Chr4g0389231 RchiOBHm_Chr4g0389421 RchiOBHm_Chr4g0396771 RchiOBHm_Chr4g0396781 RchiOBHm_Chr4g0396791 RchiOBHm_Chr4g0399631 RchiOBHm_Chr4g0399641 RchiOBHm_Chr5g0071851 RchiOBHm_Chr6g0268511
rosa_laevigata RLG00000009249 RLG00000009256 RLG00000009505 RLG00000009983 RLG00000009984 RLG00000013253
rosa_multiflora Rmu_sc0000487.1_g000011 Rmu_sc0002404.1_g000026
rosa_roxburghii Rroxscaffold_5G00335430 Rroxscaffold_5G00341610
rosa_rugosa Rorug03G0282200 Rorug03G0347600 Rorug04G0017800 Rorug04G0017800 Rorug05G0227600 Rorug06G0042400 Rorug06G0042500
rosa_samantha Rh3AG328900 Rh4AG027600 Rh4BG093100 Rh4CG029700 Rh4CG077600 Rh4CG077800 Rh4CG104100 Rh4CG104200 Rh4DG020800 Rh4DG021100 Rh4DG021200 Rh4DG067000 Rh4DG067100 Rh6AG162000 Rh6BG166300
rosa_wichuraiana Rw4G002000 Rw4G005780 Rw4G005790 Rw4G007880 Rw6G013990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 105, 138
AclWI GGATC 1 cut(s) 129
AcoI YGGCCR 1 cut(s) 361
AcyI GRCGYC 1 cut(s) 156
AflIII ACRYGT 1 cut(s) 62
AgsI TTSAA 3 cut(s) 199, 242, 355
AluBI AGCT 1 cut(s) 31
AluI AGCT 1 cut(s) 31
Alw26I GTCTC 1 cut(s) 282
AlwI GGATC 1 cut(s) 129
AoxI GGCC 3 cut(s) 214, 334, 361
AspS9I GGNCC 1 cut(s) 335
AsuHPI GGTGA 1 cut(s) 112
BalI TGGCCA 1 cut(s) 363
BarI GAAGNNNNNNTAC 2 cut(s) 307, 339
BccI CCATC 1 cut(s) 275
BceAI ACGGC 1 cut(s) 367
BcoDI GTCTC 1 cut(s) 282
BfmI CTRYAG 1 cut(s) 130
BmgT120I GGNCC 1 cut(s) 335
BmsI GCATC 1 cut(s) 58
BsaBI GATNNNNATC 1 cut(s) 147
BsaHI GRCGYC 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 383
Bse1I ACTGG 2 cut(s) 364, 364
Bse3DI GCAATG 1 cut(s) 337
Bse8I GATNNNNATC 1 cut(s) 147
BseDI CCNNGG 1 cut(s) 383
BseJI GATNNNNATC 1 cut(s) 147
BseMI GCAATG 1 cut(s) 337
BseNI ACTGG 2 cut(s) 364, 364
BshFI GGCC 3 cut(s) 216, 336, 363
BsmAI GTCTC 1 cut(s) 282
BsnI GGCC 3 cut(s) 216, 336, 363
Bsp143I GATC 2 cut(s) 134, 148
BspACI CCGC 2 cut(s) 105, 138
BspANI GGCC 3 cut(s) 216, 336, 363
BspPI GGATC 1 cut(s) 129
BsrDI GCAATG 1 cut(s) 337
BsrI ACTGG 2 cut(s) 364, 364
BssECI CCNNGG 1 cut(s) 383
BssMI GATC 2 cut(s) 134, 148
BssNI GRCGYC 1 cut(s) 156
Bst4CI ACNGT 2 cut(s) 25, 131
Bst6I CTCTTC 1 cut(s) 280
BstACI GRCGYC 1 cut(s) 156
BstDSI CCRYGG 1 cut(s) 383
BstKTI GATC 2 cut(s) 137, 151
BstMAI GTCTC 1 cut(s) 282
BstMBI GATC 2 cut(s) 134, 148
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstNSI RCATGY 1 cut(s) 66
BstSFI CTRYAG 1 cut(s) 130
BstX2I RGATCY 1 cut(s) 134
BstYI RGATCY 1 cut(s) 134
BsuRI GGCC 3 cut(s) 216, 336, 363
BtgI CCRYGG 1 cut(s) 383
BtsIMutI CAGTG 2 cut(s) 30, 127
Cfr13I GGNCC 1 cut(s) 335
CseI GACGC 1 cut(s) 145
CviAII CATG 1 cut(s) 63
CviJI RGCY 6 cut(s) 5, 31, 216, 336, 346, 363
CviKI_1 RGCY 6 cut(s) 5, 31, 216, 336, 346, 363
DpnI GATC 2 cut(s) 136, 150
DpnII GATC 2 cut(s) 134, 148
DraI TTTAAA 1 cut(s) 259
EaeI YGGCCR 1 cut(s) 361
Eam1104I CTCTTC 1 cut(s) 280
EarI CTCTTC 1 cut(s) 280
EciI GGCGGA 1 cut(s) 120
FaeI CATG 1 cut(s) 66
FaiI YATR 9 cut(s) 64, 79, 81, 186, 274, 276, 300, 317, 369
FalI AAGNNNNNCTT 2 cut(s) 153, 185
FatI CATG 1 cut(s) 62
FauNDI CATATG 1 cut(s) 79
HaeIII GGCC 3 cut(s) 216, 336, 363
HgaI GACGC 1 cut(s) 145
Hin1I GRCGYC 1 cut(s) 156
Hin1II CATG 1 cut(s) 66
HinfI GANTC 2 cut(s) 87, 115
HphI GGTGA 1 cut(s) 112
HpyCH4III ACNGT 2 cut(s) 25, 131
HpyCH4V TGCA 1 cut(s) 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
Hsp92I GRCGYC 1 cut(s) 156
Hsp92II CATG 1 cut(s) 66
Kzo9I GATC 2 cut(s) 134, 148
LpnPI CCDG 3 cut(s) 312, 345, 377
LweI GCATC 1 cut(s) 58
MalI GATC 2 cut(s) 136, 150
MboI GATC 2 cut(s) 134, 148
MboII GAAGA 4 cut(s) 30, 161, 297, 315
MflI RGATCY 1 cut(s) 134
MlsI TGGCCA 1 cut(s) 363
MluNI TGGCCA 1 cut(s) 363
MnlI CCTC 1 cut(s) 101
Mox20I TGGCCA 1 cut(s) 363
MscI TGGCCA 1 cut(s) 363
MseI TTAA 3 cut(s) 53, 258, 348
MslI CAYNNNNRTG 1 cut(s) 259
Msp20I TGGCCA 1 cut(s) 363
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeI CATATG 1 cut(s) 79
NdeII GATC 2 cut(s) 134, 148
NlaIII CATG 1 cut(s) 66
NmeAIII GCCGAG 1 cut(s) 132
NspI RCATGY 1 cut(s) 66
PciI ACATGT 1 cut(s) 62
PfeI GAWTC 2 cut(s) 87, 115
PscI ACATGT 1 cut(s) 62
PspPI GGNCC 1 cut(s) 335
PsuI RGATCY 1 cut(s) 134
RseI CAYNNNNRTG 1 cut(s) 259
SaqAI TTAA 3 cut(s) 53, 258, 348
Sau3AI GATC 2 cut(s) 134, 148
Sau96I GGNCC 1 cut(s) 335
SetI ASST 4 cut(s) 33, 125, 205, 209
SfaNI GCATC 1 cut(s) 58
SfcI CTRYAG 1 cut(s) 130
SgeI CNNG 7 cut(s) 75, 164, 220, 339, 351, 372, 376
SmiI ATTTAAAT 1 cut(s) 259
SmiMI CAYNNNNRTG 1 cut(s) 259
SsiI CCGC 2 cut(s) 105, 138
SspI AATATT 1 cut(s) 36
SwaI ATTTAAAT 1 cut(s) 259
TaaI ACNGT 2 cut(s) 25, 131
TfiI GAWTC 2 cut(s) 87, 115
Tru1I TTAA 3 cut(s) 53, 258, 348
Tru9I TTAA 3 cut(s) 53, 258, 348
TscAI CASTG 2 cut(s) 30, 134
TspDTI ATGAA 2 cut(s) 128, 243
TspRI CASTG 2 cut(s) 30, 134
XceI RCATGY 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.