FvH4_3g13170
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
7857277 .. 7857594
318 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g13170.t1

Sequence Viewer

Length: 318 bp
ATGGAAAGCCATGGAAGTTTAGAGAATCATATTTCTGCTTGGGGTGTGTCAACTTCACTCACCATTCAAATGACACTAAGAGCTGCAGTAGAGCTCGATGTGTTCAACATCATTGCCAAAGCAGGGTCTGGAGCTCATCTTACATCAAAACAAATTGTTTCCCAAATCCCAACCACAAATCCAAACTCAGCAGTTGAAAACTTGGAGAGAATTCTAAGGTTTCTCAGTGTCCATTCCTACTATCAACATCTCAAACACCAAACCCTACGATCCGACCATCAAAGACACCAGCTACGGGAAAGGATACCCTTTGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.87

Weight (kDa)

9.39

Isoelectric Point (pI)

34.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimerisation PF08100 17 - 77 1.9e-09 O-methyltransferase dimerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000656)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 264
AcsI RAATTY 1 cut(s) 210
AfiI CCNNNNNNNGG 2 cut(s) 123, 295
AgsI TTSAA 3 cut(s) 68, 106, 197
AluBI AGCT 4 cut(s) 83, 94, 134, 292
AluI AGCT 4 cut(s) 83, 94, 134, 292
Alw21I GWGCWC 2 cut(s) 96, 136
AlwI GGATC 1 cut(s) 264
AlwNI CAGNNNCTG 1 cut(s) 128
ApeKI GCWGC 1 cut(s) 83
ApoI RAATTY 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 52
BanII GRGCYC 2 cut(s) 96, 136
Bbv12I GWGCWC 2 cut(s) 96, 136
BbvI GCAGC 1 cut(s) 70
BccI CCATC 1 cut(s) 285
BciVI GTATCC 1 cut(s) 297
BfaI CTAG 1 cut(s) 316
BfmI CTRYAG 1 cut(s) 84
BfuI GTATCC 1 cut(s) 297
BisI GCNGC 1 cut(s) 84
BlsI GCNGC 1 cut(s) 85
BpmI CTGGAG 1 cut(s) 150
BsaJI CCNNGG 1 cut(s) 10
Bsc4I CCNNNNNNNGG 2 cut(s) 123, 295
Bse3DI GCAATG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 123, 295
BseMI GCAATG 1 cut(s) 111
BseMII CTCAG 2 cut(s) 201, 238
BseXI GCAGC 1 cut(s) 70
BsiHKAI GWGCWC 2 cut(s) 96, 136
BslI CCNNNNNNNGG 2 cut(s) 123, 295
Bsp1286I GDGCHC 2 cut(s) 96, 136
Bsp143I GATC 1 cut(s) 269
Bsp19I CCATGG 1 cut(s) 10
BspCNI CTCAG 2 cut(s) 200, 237
BspMAI CTGCAG 1 cut(s) 88
BspPI GGATC 1 cut(s) 264
BsrDI GCAATG 1 cut(s) 111
BssECI CCNNGG 1 cut(s) 10
BssMI GATC 1 cut(s) 269
BssT1I CCWWGG 1 cut(s) 10
BstDEI CTNAG 4 cut(s) 77, 187, 215, 224
BstDSI CCRYGG 1 cut(s) 10
BstKTI GATC 1 cut(s) 272
BstMBI GATC 1 cut(s) 269
BstSFI CTRYAG 1 cut(s) 84
BstV1I GCAGC 1 cut(s) 70
BsuI GTATCC 1 cut(s) 297
BtgI CCRYGG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 232
CaiI CAGNNNCTG 1 cut(s) 128
CviAII CATG 1 cut(s) 11
CviJI RGCY 5 cut(s) 9, 83, 94, 134, 292
CviKI_1 RGCY 5 cut(s) 9, 83, 94, 134, 292
DdeI CTNAG 4 cut(s) 77, 187, 215, 224
DpnI GATC 1 cut(s) 271
DpnII GATC 1 cut(s) 269
Ecl136II GAGCTC 2 cut(s) 94, 134
Eco130I CCWWGG 1 cut(s) 10
Eco24I GRGCYC 2 cut(s) 96, 136
Eco53kI GAGCTC 2 cut(s) 94, 134
EcoICRI GAGCTC 2 cut(s) 94, 134
EcoRI GAATTC 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 10
EcoT38I GRGCYC 2 cut(s) 96, 136
ErhI CCWWGG 1 cut(s) 10
FaeI CATG 1 cut(s) 14
FaiI YATR 2 cut(s) 12, 30
FatI CATG 1 cut(s) 10
Fnu4HI GCNGC 1 cut(s) 84
FriOI GRGCYC 2 cut(s) 96, 136
Fsp4HI GCNGC 1 cut(s) 84
FspBI CTAG 1 cut(s) 316
GluI GCNGC 1 cut(s) 84
GsuI CTGGAG 1 cut(s) 150
Hin1II CATG 1 cut(s) 14
HincII GTYRAC 1 cut(s) 51
HindII GTYRAC 1 cut(s) 51
HinfI GANTC 1 cut(s) 25
HphI GGTGA 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 51
Hpy188I TCNGA 1 cut(s) 274
Hpy188III TCNNGA 1 cut(s) 129
Hpy8I GTNNAC 1 cut(s) 51
HpyCH4V TGCA 1 cut(s) 86
HpyF3I CTNAG 4 cut(s) 77, 187, 215, 224
Hsp92II CATG 1 cut(s) 14
Kzo9I GATC 1 cut(s) 269
LmnI GCTCC 1 cut(s) 131
LpnPI CCDG 3 cut(s) 108, 114, 302
Lsp1109I GCAGC 1 cut(s) 70
MaeI CTAG 1 cut(s) 316
MalI GATC 1 cut(s) 271
MboI GATC 1 cut(s) 269
MhlI GDGCHC 2 cut(s) 96, 136
MluCI AATT 2 cut(s) 153, 210
MmeI TCCRAC 1 cut(s) 297
MslI CAYNNNNRTG 1 cut(s) 68
NcoI CCATGG 1 cut(s) 10
NdeII GATC 1 cut(s) 269
NlaIII CATG 1 cut(s) 14
PfeI GAWTC 1 cut(s) 25
PkrI GCNGC 1 cut(s) 85
Psp124BI GAGCTC 2 cut(s) 96, 136
PstI CTGCAG 1 cut(s) 88
PstNI CAGNNNCTG 1 cut(s) 128
RseI CAYNNNNRTG 1 cut(s) 68
SacI GAGCTC 2 cut(s) 96, 136
SatI GCNGC 1 cut(s) 84
Sau3AI GATC 1 cut(s) 269
SduI GDGCHC 2 cut(s) 96, 136
SetI ASST 5 cut(s) 85, 96, 136, 221, 294
SfcI CTRYAG 1 cut(s) 84
SgeI CNNG 8 cut(s) 23, 51, 107, 135, 141, 214, 301, 308
SmiMI CAYNNNNRTG 1 cut(s) 68
Sse9I AATT 2 cut(s) 153, 210
SspMI CTAG 1 cut(s) 316
SstI GAGCTC 2 cut(s) 96, 136
StyI CCWWGG 1 cut(s) 10
TaqI TCGA 1 cut(s) 96
TasI AATT 2 cut(s) 153, 210
TfiI GAWTC 1 cut(s) 25
TscAI CASTG 1 cut(s) 232
TseI GCWGC 1 cut(s) 83
TspRI CASTG 1 cut(s) 232
XapI RAATTY 1 cut(s) 210
XspI CTAG 1 cut(s) 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.