Rmu_sc0003760.1_g000034
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003760.1
OG0000656
Physical Location & Seq
Reverse (-)
103182 .. 105103
1922 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003760.1_g000034.1.cds

Sequence Viewer

Length: 894 bp
atggctctaaaagctgcaatcgaactcaatgtcttcaatatcatagccaattcaggacctggagctcatctcacatcgaaagaaattgtatctcaaatctccaccataaatccaaatgcagcagcggagaatttgaagcgaatattaagagttctgagtgtgcattctttgttatctgtatctcaaaggccaagcgtaaatggtaagacaatactagaagagacttatggtttaacaaatgatactctttgcctagttccaaatgaagatggagtttccttggctccatatattatcttagcttctgatatgacccttgtgaaaagcttgtccatgctcaaagaaacagtgcttgaacctgggagcgttcctttcaacaagactcatggagtgtccatgtatgagtacatgtctgagaaacctgagctgagccaattgtttaataaggctatgggacaaagttccatccttgattttgaagaggtgttaaatgtttacaaaggttttgaagaggtagaagagttgatggatgttgcaggaggcactggaactacaattgccaaagtagtatctagatatccacacattcaaggaattaacttcgatttacctaatgttgtcactcaaggaattgctaaataccaagcagcattaccagaaatcgggaaggtaatagttgtggagtttgcaataccagaaatagtggagaaaaccgcagatttggagaaaatagtgacattagacatcataatgatggcttatcacggtagtaaagaacgaacaattgctgagtttgactacctatcgaaagctgcaggattcagtgaaatgaagatttttccgatttcacatggtggttatgttatggaacttcacaaagttaaaacatattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko00950 ko01100 ko01110 map00940 map00950 map01100 map01110
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

297

Amino Acids

32.53

Weight (kDa)

5.25

Isoelectric Point (pI)

37.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000656)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g09630 FvH4_3g13140 FvH4_3g13141 FvH4_3g13160 FvH4_3g13170 FvH4_6g14540
malus_domestica MD10G1257600.v1.1
prunus_persica Prupe.4G086200_v2.0.a1
pyrus_communis pycom05g25920 pycom10g21380
rosa_chinensis RchiOBHm_Chr5g0014991 RchiOBHm_Chr5g0046111 RchiOBHm_Chr5g0056661 RchiOBHm_Chr7g0209941 RchiOBHm_Chr7g0211601 RchiOBHm_Chr7g0228691
rosa_laevigata RLG00000002994 RLG00000003075 RLG00000032124 RLG00000032125 RLG00000032158 RLG00000034388 RLG00000034564 RLG00000035118
rosa_multiflora Rmu_sc0003162.1_g000007 Rmu_sc0003162.1_g000010 Rmu_sc0003760.1_g000034 Rmu_sc0004232.1_g000016 Rmu_sc0004232.1_g000017 Rmu_sc0004232.1_g000023 Rmu_sc0004889.1_g000017 Rmu_sc0008669.1_g000001 Rmu_sc0009240.1_g000017 Rmu_sc0009255.1_g000012 Rmu_sc0013112.1_g000007
rosa_roxburghii Rroxscaffold_1G00023690 Rroxscaffold_1G00035370 Rroxscaffold_1G00035380 Rroxscaffold_1G00061590 Rroxscaffold_1G00061940 Rroxscaffold_3G00230880 Rroxscaffold_3G00247690
rosa_rugosa Rorug05G0019200 Rorug05G0022400 Rorug05G0225700 Rorug05G0246400 Rorug05G0301100 Rorug07G0117600 Rorug07G0126200
rosa_samantha Rh5AG114200 Rh5AG114300 Rh5AG117800 Rh5BG111300 Rh5BG115000 Rh5BG314800 Rh5BG383300 Rh5CG126300 Rh5CG359500 Rh5CG406400 Rh5DG110100 Rh5DG110600 Rh5DG114500 Rh5DG396000 Rh5DG396100 Rh7AG251400 Rh7AG403800 Rh7BG246000 Rh7CG268200 Rh7DG258000 Rh7DG266400
rosa_wichuraiana Rw5G009920 Rw5G010150 Rw5G028650 Rw5G034830 Rw7G021330 Rw7G022120 Rw7G033560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 125, 714
AcsI RAATTY 1 cut(s) 130
AdeI CACNNNGTG 1 cut(s) 854
AfaI GTAC 1 cut(s) 407
AfiI CCNNNNNNNGG 1 cut(s) 662
AflIII ACRYGT 1 cut(s) 408
AgsI TTSAA 7 cut(s) 37, 136, 356, 376, 479, 509, 590
AjnI CCWGG 2 cut(s) 58, 358
AluBI AGCT 6 cut(s) 14, 65, 302, 327, 427, 812
AluI AGCT 6 cut(s) 14, 65, 302, 327, 427, 812
Alw21I GWGCWC 1 cut(s) 67
Alw26I GTCTC 1 cut(s) 215
AlwNI CAGNNNCTG 1 cut(s) 59
AoxI GGCC 1 cut(s) 188
ApeKI GCWGC 5 cut(s) 14, 119, 122, 647, 812
ApoI RAATTY 1 cut(s) 130
ArsI GACNNNNNNTTYG 2 cut(s) 15, 47
AspS9I GGNCC 1 cut(s) 56
AvaII GGWCC 1 cut(s) 56
BanII GRGCYC 1 cut(s) 67
BbsI GAAGAC 1 cut(s) 25
Bbv12I GWGCWC 1 cut(s) 67
BbvI GCAGC 4 cut(s) 131, 134, 659, 799
BccI CCATC 4 cut(s) 263, 473, 520, 748
BciT130I CCWGG 2 cut(s) 60, 360
BcoDI GTCTC 1 cut(s) 215
BfaI CTAG 3 cut(s) 215, 254, 573
BfmI CTRYAG 1 cut(s) 813
BisI GCNGC 5 cut(s) 15, 120, 123, 648, 813
BlpI GCTNAGC 1 cut(s) 428
BlsI GCNGC 5 cut(s) 16, 121, 124, 649, 814
Bme1390I CCNGG 2 cut(s) 60, 360
Bme18I GGWCC 1 cut(s) 56
BmgT120I GGNCC 1 cut(s) 56
BmiI GGNNCC 1 cut(s) 285
BmrFI CCNGG 2 cut(s) 60, 360
BpiI GAAGAC 1 cut(s) 25
BplI GAGNNNNNCTC 2 cut(s) 54, 86
BpmI CTGGAG 1 cut(s) 81
Bpu10I CCTNAGC 1 cut(s) 423
Bpu1102I GCTNAGC 1 cut(s) 428
BpuEI CTTGAG 1 cut(s) 609
BsaJI CCNNGG 2 cut(s) 279, 359
Bsc4I CCNNNNNNNGG 1 cut(s) 662
Bse1I ACTGG 1 cut(s) 550
BseBI CCWGG 2 cut(s) 60, 360
BseDI CCNNGG 2 cut(s) 279, 359
BseGI GGATG 2 cut(s) 465, 535
BseLI CCNNNNNNNGG 1 cut(s) 662
BseMII CTCAG 5 cut(s) 146, 405, 414, 419, 780
BseNI ACTGG 1 cut(s) 550
BseXI GCAGC 4 cut(s) 131, 134, 659, 799
BshFI GGCC 1 cut(s) 190
BsiHKAI GWGCWC 1 cut(s) 67
BslFI GGGAC 1 cut(s) 468
BslI CCNNNNNNNGG 1 cut(s) 662
BsmAI GTCTC 1 cut(s) 215
BsmFI GGGAC 1 cut(s) 468
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 1 cut(s) 190
Bsp1286I GDGCHC 1 cut(s) 67
Bsp1720I GCTNAGC 1 cut(s) 428
BspACI CCGC 2 cut(s) 125, 714
BspANI GGCC 1 cut(s) 190
BspCNI CTCAG 5 cut(s) 147, 406, 415, 420, 781
BspLI GGNNCC 1 cut(s) 285
BspMAI CTGCAG 1 cut(s) 817
BsrI ACTGG 1 cut(s) 550
BssECI CCNNGG 2 cut(s) 279, 359
BssT1I CCWWGG 1 cut(s) 279
Bst2UI CCWGG 2 cut(s) 60, 360
Bst4CI ACNGT 2 cut(s) 349, 767
Bst6I CTCTTC 4 cut(s) 213, 474, 504, 513
BstDEI CTNAG 6 cut(s) 155, 298, 414, 423, 428, 789
BstF5I GGATG 2 cut(s) 465, 535
BstMAI GTCTC 1 cut(s) 215
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 2 cut(s) 60, 360
BstNSI RCATGY 1 cut(s) 412
BstSCI CCNGG 2 cut(s) 58, 358
BstSFI CTRYAG 1 cut(s) 813
BstV1I GCAGC 4 cut(s) 131, 134, 659, 799
BstV2I GAAGAC 1 cut(s) 25
BsuRI GGCC 1 cut(s) 190
BtsCI GGATG 2 cut(s) 465, 535
BtsIMutI CAGTG 3 cut(s) 354, 543, 829
CaiI CAGNNNCTG 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 406
CviAII CATG 5 cut(s) 334, 386, 397, 409, 851
CviQI GTAC 1 cut(s) 406
DdeI CTNAG 6 cut(s) 155, 298, 414, 423, 428, 789
DraIII CACNNNGTG 1 cut(s) 854
Eam1104I CTCTTC 4 cut(s) 213, 474, 504, 513
EarI CTCTTC 4 cut(s) 213, 474, 504, 513
Ecl136II GAGCTC 1 cut(s) 65
Eco130I CCWWGG 1 cut(s) 279
Eco24I GRGCYC 1 cut(s) 67
Eco32I GATATC 1 cut(s) 578
Eco47I GGWCC 1 cut(s) 56
Eco53kI GAGCTC 1 cut(s) 65
EcoICRI GAGCTC 1 cut(s) 65
EcoO109I RGGNCCY 1 cut(s) 56
EcoRII CCWGG 2 cut(s) 58, 358
EcoRV GATATC 1 cut(s) 578
EcoT14I CCWWGG 1 cut(s) 279
EcoT38I GRGCYC 1 cut(s) 67
ErhI CCWWGG 1 cut(s) 279
FaeI CATG 5 cut(s) 337, 389, 400, 412, 854
FaqI GGGAC 1 cut(s) 468
FatI CATG 5 cut(s) 333, 385, 396, 408, 850
Fnu4HI GCNGC 5 cut(s) 15, 120, 123, 648, 813
FokI GGATG 2 cut(s) 452, 542
FriOI GRGCYC 1 cut(s) 67
Fsp4HI GCNGC 5 cut(s) 15, 120, 123, 648, 813
FspBI CTAG 3 cut(s) 215, 254, 573
GluI GCNGC 5 cut(s) 15, 120, 123, 648, 813
GsuI CTGGAG 1 cut(s) 81
HaeIII GGCC 1 cut(s) 190
Hin1II CATG 5 cut(s) 337, 389, 400, 412, 854
HindIII AAGCTT 1 cut(s) 325
HinfI GANTC 2 cut(s) 382, 819
Hpy166II GTNNAC 1 cut(s) 496
Hpy188I TCNGA 4 cut(s) 156, 307, 415, 843
Hpy188III TCNNGA 3 cut(s) 54, 573, 664
Hpy8I GTNNAC 1 cut(s) 496
HpyAV CCTTC 1 cut(s) 661
HpyCH4III ACNGT 2 cut(s) 349, 767
HpyCH4V TGCA 6 cut(s) 17, 119, 163, 536, 689, 815
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 6 cut(s) 155, 298, 414, 423, 428, 789
Hsp92II CATG 5 cut(s) 337, 389, 400, 412, 854
LmnI GCTCC 3 cut(s) 62, 289, 363
Lsp1109I GCAGC 4 cut(s) 131, 134, 659, 799
MaeI CTAG 3 cut(s) 215, 254, 573
MaeIII GTNAC 2 cut(s) 619, 733
MboII GAAGA 7 cut(s) 25, 230, 278, 491, 521, 530, 844
MfeI CAATTG 3 cut(s) 434, 555, 783
MhlI GDGCHC 1 cut(s) 67
MluCI AATT 8 cut(s) 49, 84, 130, 434, 555, 594, 630, 783
MlyI GAGTC 1 cut(s) 376
MnlI CCTC 3 cut(s) 475, 505, 533
MseI TTAA 6 cut(s) 146, 233, 441, 488, 597, 882
MslI CAYNNNNRTG 2 cut(s) 749, 752
MspA1I CMGCKG 1 cut(s) 125
MspR9I CCNGG 2 cut(s) 60, 360
MunI CAATTG 3 cut(s) 434, 555, 783
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 2 cut(s) 60, 360
MwoI GCNNNNNNNGC 1 cut(s) 11
NlaIII CATG 5 cut(s) 337, 389, 400, 412, 854
NlaIV GGNNCC 1 cut(s) 285
NmuCI GTSAC 2 cut(s) 619, 733
NspI RCATGY 1 cut(s) 412
PciI ACATGT 1 cut(s) 408
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 1 cut(s) 819
PkrI GCNGC 5 cut(s) 16, 121, 124, 649, 814
PleI GAGTC 1 cut(s) 376
PpsI GAGTC 1 cut(s) 376
PpuMI RGGWCCY 1 cut(s) 56
PscI ACATGT 1 cut(s) 408
Psp124BI GAGCTC 1 cut(s) 67
Psp5II RGGWCCY 1 cut(s) 56
Psp6I CCWGG 2 cut(s) 58, 358
PspGI CCWGG 2 cut(s) 58, 358
PspN4I GGNNCC 1 cut(s) 285
PspPI GGNCC 1 cut(s) 56
PspPPI RGGWCCY 1 cut(s) 56
PstI CTGCAG 1 cut(s) 817
PstNI CAGNNNCTG 1 cut(s) 59
RsaI GTAC 1 cut(s) 407
RsaNI GTAC 1 cut(s) 406
RseI CAYNNNNRTG 2 cut(s) 749, 752
SacI GAGCTC 1 cut(s) 67
SaqAI TTAA 6 cut(s) 146, 233, 441, 488, 597, 882
SatI GCNGC 5 cut(s) 15, 120, 123, 648, 813
Sau96I GGNCC 1 cut(s) 56
SchI GAGTC 1 cut(s) 376
ScrFI CCNGG 2 cut(s) 60, 360
SduI GDGCHC 1 cut(s) 67
SfcI CTRYAG 1 cut(s) 813
SinI GGWCC 1 cut(s) 56
SmiMI CAYNNNNRTG 2 cut(s) 749, 752
SmlI CTYRAG 1 cut(s) 624
SmoI CTYRAG 1 cut(s) 624
Sse9I AATT 8 cut(s) 49, 84, 130, 434, 555, 594, 630, 783
SsiI CCGC 2 cut(s) 125, 714
SspI AATATT 1 cut(s) 144
SspMI CTAG 3 cut(s) 215, 254, 573
SstI GAGCTC 1 cut(s) 67
StyD4I CCNGG 2 cut(s) 58, 358
StyI CCWWGG 1 cut(s) 279
TaaI ACNGT 2 cut(s) 349, 767
TaqI TCGA 4 cut(s) 21, 77, 603, 806
TasI AATT 8 cut(s) 49, 84, 130, 434, 555, 594, 630, 783
TatI WGTACW 1 cut(s) 405
TfiI GAWTC 1 cut(s) 819
Tru1I TTAA 6 cut(s) 146, 233, 441, 488, 597, 882
Tru9I TTAA 6 cut(s) 146, 233, 441, 488, 597, 882
TscAI CASTG 3 cut(s) 354, 550, 829
TseFI GTSAC 2 cut(s) 619, 733
TseI GCWGC 5 cut(s) 14, 119, 122, 647, 812
Tsp45I GTSAC 2 cut(s) 619, 733
TspDTI ATGAA 2 cut(s) 279, 845
TspRI CASTG 3 cut(s) 354, 550, 829
VpaK11BI GGWCC 1 cut(s) 56
XapI RAATTY 1 cut(s) 130
XbaI TCTAGA 1 cut(s) 572
XceI RCATGY 1 cut(s) 412
XspI CTAG 3 cut(s) 215, 254, 573
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.