Prupe.4G086200_v2.0.a1
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
4246589 .. 4248178
1590 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G086200.1

Sequence Viewer

Length: 1080 bp
ATGGAAAACACGAGAAGTCTTGAAAATATTGTCTCAGCTAGAGGTTTGATAAATTTCATTCCCATCCAAATGACCCTAAAAGCTGCAATTGAGCTAAATGTCTTCAGCATCATAGCCAAGTCAGGGCCAGCATCTCATCTCACAGCAAAAGAAATTGCCTCACAAATTCCAACTTCAAATCCAAATGCAGCTGGGAATTTGGAGAGAATTCTGAGACTGCTGGCTGCCCATTCCCTCCTATCCACAACCCTAAACCCATGCCCAAATGATGAGACATTGCAAGAAAGGGCTTATGGCCTCACAAATGAGACACTCTGCTTGGTTCCAGATGAAAATGGAGTTTCATTGGCCCCATTTATAATTTTGAACTCTGAACTTGAGATTGTGAAGAGCTTGTACATGCTCAAGCACACAGTGCTTGAACCAGACTTCTTGCCCTTCTGCAAGGCCCATGGAATTACCATTTATGAGTACATGTCCAAGAAACCCGAGATGAGCCAATTGTTTAACAAGTCTATGGCTGAAACTTCTAACCTAAATTTTAGTGAGGTGTTAAAGGTTTACAAAGGGTTTGAGGAGGTGAAGGAGTTGATGGATGTAGGGGGTGGCATTGGAACTTCCATGTCAGAAGTAGTTTCCATGTATCCCCACATCCATGGAATTAACTTTGATTTGCCCAATGTTGTTGCCCAAGCTCCTACGTACCAAGGTGTGAATCATGTTGGTGGAAATATGTTTGAGACGATACCAAATGCACAATCTATTATGTTGAAGTGGGTGCTCCATAACTGGGGAGATGATCAATGCAAGAAAGTATTGAGAAATTGTTGGGAGGCATTGCCAAAAAGTGGGAAGGTGATAGTTGTGGAATTTGCAATACCTGAAGAACTGGAGAAGACAAAAGCGGTGTTGAACATAGTAACCTTGGACATCACAATGATGGCATGTCCTGGCGGTAAGGAACGAACAACAACTGAGTTTGCTAACTTAGCAAAACATGTAGGTTTTGTCGAAACTAAATTTTTTCCAATCTCATATGGGATTTATGTTTTGGAGTTTCTCAAGATAGAAGAAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

360

Amino Acids

39.8

Weight (kDa)

5.46

Isoelectric Point (pI)

36.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000656)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 359
AccB7I CCANNNNNTGG 1 cut(s) 848
AciI CCGC 2 cut(s) 905, 954
AcsI RAATTY 7 cut(s) 52, 165, 196, 207, 538, 869, 1019
AcuI CTGAAG 2 cut(s) 88, 903
AdeI CACNNNGTG 1 cut(s) 415
AfaI GTAC 3 cut(s) 398, 473, 704
AfiI CCNNNNNNNGG 3 cut(s) 123, 790, 848
AflIII ACRYGT 2 cut(s) 474, 997
AgsI TTSAA 6 cut(s) 23, 177, 367, 422, 772, 913
AjnI CCWGG 1 cut(s) 949
AluBI AGCT 6 cut(s) 38, 83, 94, 191, 393, 695
AluI AGCT 6 cut(s) 38, 83, 94, 191, 393, 695
Alw21I GWGCWC 1 cut(s) 783
Alw26I GTCTC 5 cut(s) 37, 208, 266, 302, 734
Ama87I CYCGRG 1 cut(s) 488
AoxI GGCC 4 cut(s) 125, 295, 348, 447
ApeKI GCWGC 3 cut(s) 83, 188, 224
ApoI RAATTY 7 cut(s) 52, 165, 196, 207, 538, 869, 1019
AspS9I GGNCC 3 cut(s) 125, 349, 448
AsuHPI GGTGA 2 cut(s) 592, 868
AvaI CYCGRG 1 cut(s) 488
BarI GAAGNNNNNNTAC 2 cut(s) 380, 412
BauI CACGAG 1 cut(s) 10
BbsI GAAGAC 2 cut(s) 94, 902
Bbv12I GWGCWC 1 cut(s) 783
BbvI GCAGC 3 cut(s) 70, 200, 211
BccI CCATC 3 cut(s) 71, 586, 934
BciT130I CCWGG 1 cut(s) 951
BciVI GTATCC 1 cut(s) 654
BclI TGATCA 1 cut(s) 799
BcoDI GTCTC 5 cut(s) 37, 208, 266, 302, 734
BfaI CTAG 1 cut(s) 39
BfuI GTATCC 1 cut(s) 654
BisI GCNGC 3 cut(s) 84, 189, 225
BlsI GCNGC 3 cut(s) 85, 190, 226
Bme1390I CCNGG 1 cut(s) 951
BmeT110I CYCGRG 1 cut(s) 488
BmgT120I GGNCC 3 cut(s) 125, 349, 448
BmiI GGNNCC 2 cut(s) 324, 351
BmrFI CCNGG 1 cut(s) 951
BmrI ACTGGG 1 cut(s) 799
BmsI GCATC 2 cut(s) 117, 140
BmuI ACTGGG 1 cut(s) 799
BpiI GAAGAC 2 cut(s) 94, 902
BpmI CTGGAG 1 cut(s) 911
BpuEI CTTGAG 3 cut(s) 389, 398, 1046
BsaAI YACGTR 1 cut(s) 702
BsaJI CCNNGG 4 cut(s) 451, 655, 706, 924
Bsc4I CCNNNNNNNGG 3 cut(s) 123, 790, 848
Bse1I ACTGG 2 cut(s) 794, 894
Bse3DI GCAATG 2 cut(s) 275, 836
BseBI CCWGG 1 cut(s) 951
BseDI CCNNGG 4 cut(s) 451, 655, 706, 924
BseGI GGATG 3 cut(s) 63, 601, 651
BseLI CCNNNNNNNGG 3 cut(s) 123, 790, 848
BseMI GCAATG 2 cut(s) 275, 836
BseMII CTCAG 3 cut(s) 48, 203, 966
BseNI ACTGG 2 cut(s) 794, 894
BseRI GAGGAG 1 cut(s) 590
BseXI GCAGC 3 cut(s) 70, 200, 211
BseYI CCCAGC 1 cut(s) 191
BshFI GGCC 4 cut(s) 127, 297, 350, 449
BsiHKAI GWGCWC 1 cut(s) 783
BsiHKCI CYCGRG 1 cut(s) 488
BslI CCNNNNNNNGG 3 cut(s) 123, 790, 848
BsmAI GTCTC 5 cut(s) 37, 208, 266, 302, 734
BsmBI CGTCTC 1 cut(s) 734
BsnI GGCC 4 cut(s) 127, 297, 350, 449
BsoBI CYCGRG 1 cut(s) 488
Bsp1286I GDGCHC 1 cut(s) 783
Bsp1407I TGTACA 1 cut(s) 396
Bsp143I GATC 1 cut(s) 799
Bsp19I CCATGG 2 cut(s) 451, 655
BspACI CCGC 2 cut(s) 905, 954
BspANI GGCC 4 cut(s) 127, 297, 350, 449
BspCNI CTCAG 3 cut(s) 47, 204, 967
BspLI GGNNCC 2 cut(s) 324, 351
BspQI GCTCTTC 1 cut(s) 383
BsrDI GCAATG 2 cut(s) 275, 836
BsrGI TGTACA 1 cut(s) 396
BsrI ACTGG 2 cut(s) 794, 894
BssECI CCNNGG 4 cut(s) 451, 655, 706, 924
BssMI GATC 1 cut(s) 799
BssSI CACGAG 1 cut(s) 10
BssT1I CCWWGG 4 cut(s) 451, 655, 706, 924
Bst2BI CACGAG 1 cut(s) 10
Bst2UI CCWGG 1 cut(s) 951
Bst4CI ACNGT 1 cut(s) 415
Bst6I CTCTTC 1 cut(s) 383
BstAPI GCANNNNNTGC 1 cut(s) 415
BstAUI TGTACA 1 cut(s) 396
BstBAI YACGTR 1 cut(s) 702
BstC8I GCNNGC 2 cut(s) 129, 222
BstDEI CTNAG 4 cut(s) 34, 212, 975, 988
BstDSI CCRYGG 2 cut(s) 451, 655
BstF5I GGATG 3 cut(s) 63, 601, 651
BstKTI GATC 1 cut(s) 802
BstMAI GTCTC 5 cut(s) 37, 208, 266, 302, 734
BstMBI GATC 1 cut(s) 799
BstMWI GCNNNNNNNGC 2 cut(s) 415, 989
BstNI CCWGG 1 cut(s) 951
BstNSI RCATGY 4 cut(s) 403, 478, 948, 1001
BstSCI CCNGG 1 cut(s) 949
BstSNI TACGTA 1 cut(s) 702
BstV1I GCAGC 3 cut(s) 70, 200, 211
BstV2I GAAGAC 2 cut(s) 94, 902
BstXI CCANNNNNNTGG 1 cut(s) 656
BsuI GTATCC 1 cut(s) 654
BsuRI GGCC 4 cut(s) 127, 297, 350, 449
BtgI CCRYGG 2 cut(s) 451, 655
BtsCI GGATG 3 cut(s) 63, 601, 651
BtsIMutI CAGTG 1 cut(s) 420
Cac8I GCNNGC 2 cut(s) 129, 222
Cfr13I GGNCC 3 cut(s) 125, 349, 448
Csp6I GTAC 3 cut(s) 397, 472, 703
CviQI GTAC 3 cut(s) 397, 472, 703
DdeI CTNAG 4 cut(s) 34, 212, 975, 988
DpnI GATC 1 cut(s) 801
DpnII GATC 1 cut(s) 799
DraIII CACNNNGTG 1 cut(s) 415
Eam1104I CTCTTC 1 cut(s) 383
EarI CTCTTC 1 cut(s) 383
Eco105I TACGTA 1 cut(s) 702
Eco130I CCWWGG 4 cut(s) 451, 655, 706, 924
Eco57I CTGAAG 2 cut(s) 88, 903
Eco88I CYCGRG 1 cut(s) 488
EcoRI GAATTC 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 949
EcoT14I CCWWGG 4 cut(s) 451, 655, 706, 924
ErhI CCWWGG 4 cut(s) 451, 655, 706, 924
Esp3I CGTCTC 1 cut(s) 734
FauNDI CATATG 1 cut(s) 1036
FbaI TGATCA 1 cut(s) 799
Fnu4HI GCNGC 3 cut(s) 84, 189, 225
FokI GGATG 3 cut(s) 50, 608, 638
Fsp4HI GCNGC 3 cut(s) 84, 189, 225
FspBI CTAG 1 cut(s) 39
GluI GCNGC 3 cut(s) 84, 189, 225
GsaI CCCAGC 1 cut(s) 195
GsuI CTGGAG 1 cut(s) 911
HaeIII GGCC 4 cut(s) 127, 297, 350, 449
HinfI GANTC 1 cut(s) 715
HphI GGTGA 2 cut(s) 592, 868
Hpy166II GTNNAC 1 cut(s) 562
Hpy188I TCNGA 3 cut(s) 213, 373, 628
Hpy188III TCNNGA 3 cut(s) 20, 326, 1063
Hpy8I GTNNAC 1 cut(s) 562
HpyAV CCTTC 3 cut(s) 448, 577, 847
HpyCH4III ACNGT 1 cut(s) 415
HpyCH4IV ACGT 1 cut(s) 701
HpyCH4V TGCA 7 cut(s) 86, 188, 280, 444, 755, 807, 875
HpyF10VI GCNNNNNNNGC 2 cut(s) 415, 989
HpyF3I CTNAG 4 cut(s) 34, 212, 975, 988
HpySE526I ACGT 1 cut(s) 701
Ksp22I TGATCA 1 cut(s) 799
Kzo9I GATC 1 cut(s) 799
LguI GCTCTTC 1 cut(s) 383
LmnI GCTCC 2 cut(s) 700, 786
Lsp1109I GCAGC 3 cut(s) 70, 200, 211
LweI GCATC 2 cut(s) 117, 140
MaeI CTAG 1 cut(s) 39
MaeII ACGT 1 cut(s) 701
MaeIII GTNAC 1 cut(s) 919
MalI GATC 1 cut(s) 801
MboI GATC 1 cut(s) 799
MboII GAAGA 4 cut(s) 94, 400, 896, 907
MfeI CAATTG 2 cut(s) 87, 500
MhlI GDGCHC 1 cut(s) 783
MmeI TCCRAC 1 cut(s) 194
MnlI CCTC 8 cut(s) 35, 169, 245, 308, 541, 568, 571, 826
MseI TTAA 3 cut(s) 507, 554, 663
MslI CAYNNNNRTG 5 cut(s) 68, 654, 723, 935, 938
MspA1I CMGCKG 1 cut(s) 191
MspR9I CCNGG 1 cut(s) 951
MunI CAATTG 2 cut(s) 87, 500
MvaI CCWGG 1 cut(s) 951
MwoI GCNNNNNNNGC 2 cut(s) 415, 989
NcoI CCATGG 2 cut(s) 451, 655
NdeI CATATG 1 cut(s) 1036
NdeII GATC 1 cut(s) 799
NlaIV GGNNCC 2 cut(s) 324, 351
NspI RCATGY 4 cut(s) 403, 478, 948, 1001
PciI ACATGT 2 cut(s) 474, 997
PciSI GCTCTTC 1 cut(s) 383
PfeI GAWTC 1 cut(s) 715
PflMI CCANNNNNTGG 1 cut(s) 848
PkrI GCNGC 3 cut(s) 85, 190, 226
Ppu21I YACGTR 1 cut(s) 702
PscI ACATGT 2 cut(s) 474, 997
PsiI TTATAA 1 cut(s) 359
Psp6I CCWGG 1 cut(s) 949
PspFI CCCAGC 1 cut(s) 191
PspGI CCWGG 1 cut(s) 949
PspN4I GGNNCC 2 cut(s) 324, 351
PspPI GGNCC 3 cut(s) 125, 349, 448
PvuII CAGCTG 1 cut(s) 191
RsaI GTAC 3 cut(s) 398, 473, 704
RsaNI GTAC 3 cut(s) 397, 472, 703
RseI CAYNNNNRTG 5 cut(s) 68, 654, 723, 935, 938
SapI GCTCTTC 1 cut(s) 383
SaqAI TTAA 3 cut(s) 507, 554, 663
SatI GCNGC 3 cut(s) 84, 189, 225
Sau3AI GATC 1 cut(s) 799
Sau96I GGNCC 3 cut(s) 125, 349, 448
ScrFI CCNGG 1 cut(s) 951
SduI GDGCHC 1 cut(s) 783
SfaNI GCATC 2 cut(s) 117, 140
SmiMI CAYNNNNRTG 5 cut(s) 68, 654, 723, 935, 938
SmlI CTYRAG 3 cut(s) 377, 404, 1061
SmoI CTYRAG 3 cut(s) 377, 404, 1061
SnaBI TACGTA 1 cut(s) 702
SsiI CCGC 2 cut(s) 905, 954
SspI AATATT 1 cut(s) 28
SspMI CTAG 1 cut(s) 39
StyD4I CCNGG 1 cut(s) 949
StyI CCWWGG 4 cut(s) 451, 655, 706, 924
TaaI ACNGT 1 cut(s) 415
TaiI ACGT 1 cut(s) 704
TaqI TCGA 1 cut(s) 1011
TatI WGTACW 2 cut(s) 396, 471
TfiI GAWTC 1 cut(s) 715
Tru1I TTAA 3 cut(s) 507, 554, 663
Tru9I TTAA 3 cut(s) 507, 554, 663
TscAI CASTG 1 cut(s) 420
TseI GCWGC 3 cut(s) 83, 188, 224
TspDTI ATGAA 3 cut(s) 46, 333, 345
TspRI CASTG 1 cut(s) 420
Van91I CCANNNNNTGG 1 cut(s) 848
XapI RAATTY 7 cut(s) 52, 165, 196, 207, 538, 869, 1019
XceI RCATGY 4 cut(s) 403, 478, 948, 1001
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.