Rmu_sc0013112.1_g000007
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013112.1
OG0000656
Physical Location & Seq
Forward (+)
30596 .. 31369
774 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013112.1_g000007.1.cds

Sequence Viewer

Length: 774 bp
atggaaaaccagagaattatctcagaaaactatgtctctgcttggaatttgggaggtctagttgtcactcaaatggctctgaaagctgcaattgagctcaacgtcttcaatatcattgccaattcaggacccggagctcatctcacatcgaaagaaattgtatctcaaatttcaactgagaatccaaatgtagcagctgcgaatttgaagcgaatactaagagttctaagtgttcactctctgctctctgttcaaaggccaagctcaagtggtaaaacaatgcaagaagagacttatggtctaacaaaggagactctttggctagttccaaatgaggatggagtttccttagctccatttattttgttattttctgaaatggacatggtgaaaagcttatccatgctcaaagacacagtgcttgaacctgggtgccttcctttcaacaaggcttatggtatgtccatatatgagtacttgtctgagaaacctgacctgagccaattatttaataagggtgtaggccaaaattccatcctcgattttgaagaggtgttaaaggtttacaaaggttttgaagaggtagaagagttgatggatgttggaggaggtgatggaatgacaatttcaaaagtagtatctagatatccacacattcatgggattaactttgatttgcctaacgttatcgctcaaggaactgctaaatatcaaacaggtcagtatataataagtgctacaacaacatgcatgtacaatttctctttcatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko00950 ko01100 ko01110 map00940 map00950 map01100 map01110
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

257

Amino Acids

28.35

Weight (kDa)

5.06

Isoelectric Point (pI)

39.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000656)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g09630 FvH4_3g13140 FvH4_3g13141 FvH4_3g13160 FvH4_3g13170 FvH4_6g14540
malus_domestica MD10G1257600.v1.1
prunus_persica Prupe.4G086200_v2.0.a1
pyrus_communis pycom05g25920 pycom10g21380
rosa_chinensis RchiOBHm_Chr5g0014991 RchiOBHm_Chr5g0046111 RchiOBHm_Chr5g0056661 RchiOBHm_Chr7g0209941 RchiOBHm_Chr7g0211601 RchiOBHm_Chr7g0228691
rosa_laevigata RLG00000002994 RLG00000003075 RLG00000032124 RLG00000032125 RLG00000032158 RLG00000034388 RLG00000034564 RLG00000035118
rosa_multiflora Rmu_sc0003162.1_g000007 Rmu_sc0003162.1_g000010 Rmu_sc0003760.1_g000034 Rmu_sc0004232.1_g000016 Rmu_sc0004232.1_g000017 Rmu_sc0004232.1_g000023 Rmu_sc0004889.1_g000017 Rmu_sc0008669.1_g000001 Rmu_sc0009240.1_g000017 Rmu_sc0009255.1_g000012 Rmu_sc0013112.1_g000007
rosa_roxburghii Rroxscaffold_1G00023690 Rroxscaffold_1G00035370 Rroxscaffold_1G00035380 Rroxscaffold_1G00061590 Rroxscaffold_1G00061940 Rroxscaffold_3G00230880 Rroxscaffold_3G00247690
rosa_rugosa Rorug05G0019200 Rorug05G0022400 Rorug05G0225700 Rorug05G0246400 Rorug05G0301100 Rorug07G0117600 Rorug07G0126200
rosa_samantha Rh5AG114200 Rh5AG114300 Rh5AG117800 Rh5BG111300 Rh5BG115000 Rh5BG314800 Rh5BG383300 Rh5CG126300 Rh5CG359500 Rh5CG406400 Rh5DG110100 Rh5DG110600 Rh5DG114500 Rh5DG396000 Rh5DG396100 Rh7AG251400 Rh7AG403800 Rh7BG246000 Rh7CG268200 Rh7DG258000 Rh7DG266400
rosa_wichuraiana Rw5G009920 Rw5G010150 Rw5G028650 Rw5G034830 Rw7G021330 Rw7G022120 Rw7G033560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 432
AclI AACGTT 1 cut(s) 684
AcsI RAATTY 4 cut(s) 46, 168, 202, 529
AfaI GTAC 2 cut(s) 476, 755
AgsI TTSAA 9 cut(s) 109, 174, 208, 254, 425, 445, 548, 578, 630
AhdI GACNNNNNGTC 1 cut(s) 297
AjnI CCWGG 1 cut(s) 427
AluBI AGCT 7 cut(s) 86, 97, 137, 197, 264, 353, 396
AluI AGCT 7 cut(s) 86, 97, 137, 197, 264, 353, 396
Alw21I GWGCWC 2 cut(s) 99, 139
Alw26I GTCTC 3 cut(s) 40, 284, 305
AoxI GGCC 2 cut(s) 257, 523
ApeKI GCWGC 3 cut(s) 86, 194, 197
ApoI RAATTY 4 cut(s) 46, 168, 202, 529
AspS9I GGNCC 1 cut(s) 128
AsuC2I CCSGG 1 cut(s) 132
AsuHPI GGTGA 2 cut(s) 400, 623
AvaII GGWCC 1 cut(s) 128
BanI GGYRCC 1 cut(s) 432
BanII GRGCYC 2 cut(s) 99, 139
BbsI GAAGAC 1 cut(s) 97
Bbv12I GWGCWC 2 cut(s) 99, 139
BbvI GCAGC 3 cut(s) 73, 184, 206
BccI CCATC 4 cut(s) 332, 542, 589, 608
BciT130I CCWGG 1 cut(s) 429
BcnI CCSGG 1 cut(s) 132
BcoDI GTCTC 3 cut(s) 40, 284, 305
BfaI CTAG 3 cut(s) 59, 323, 642
BisI GCNGC 3 cut(s) 87, 195, 198
BlsI GCNGC 3 cut(s) 88, 196, 199
BmcAI AGTACT 1 cut(s) 476
Bme1390I CCNGG 2 cut(s) 132, 429
Bme18I GGWCC 1 cut(s) 128
BmeRI GACNNNNNGTC 1 cut(s) 297
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 2 cut(s) 130, 434
BmrFI CCNGG 2 cut(s) 132, 429
BpiI GAAGAC 1 cut(s) 97
BplI GAGNNNNNCTC 2 cut(s) 126, 158
Bpu10I CCTNAGC 2 cut(s) 349, 497
BpuEI CTTGAG 2 cut(s) 250, 678
BpuMI CCSGG 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 428
BsaXI ACNNNNNCTCC 2 cut(s) 45, 75
Bse3DI GCAATG 1 cut(s) 114
BseBI CCWGG 1 cut(s) 429
BseDI CCNNGG 1 cut(s) 428
BseGI GGATG 3 cut(s) 343, 534, 604
BseMI GCAATG 1 cut(s) 114
BseMII CTCAG 4 cut(s) 36, 168, 474, 488
BseRI GAGGAG 1 cut(s) 621
BseXI GCAGC 3 cut(s) 73, 184, 206
BshFI GGCC 2 cut(s) 259, 525
BshNI GGYRCC 1 cut(s) 432
BsiHKAI GWGCWC 2 cut(s) 99, 139
BsiSI CCGG 1 cut(s) 132
BsmAI GTCTC 3 cut(s) 40, 284, 305
BsnI GGCC 2 cut(s) 259, 525
Bsp1286I GDGCHC 2 cut(s) 99, 139
Bsp1407I TGTACA 1 cut(s) 753
BspANI GGCC 2 cut(s) 259, 525
BspCNI CTCAG 4 cut(s) 35, 169, 475, 489
BspLI GGNNCC 2 cut(s) 130, 434
BspT107I GGYRCC 1 cut(s) 432
BsrDI GCAATG 1 cut(s) 114
BsrGI TGTACA 1 cut(s) 753
BssECI CCNNGG 1 cut(s) 428
Bst2UI CCWGG 1 cut(s) 429
Bst4CI ACNGT 1 cut(s) 418
Bst6I CTCTTC 4 cut(s) 282, 543, 573, 582
BstAUI TGTACA 1 cut(s) 753
BstDEI CTNAG 7 cut(s) 22, 177, 218, 227, 349, 483, 497
BstF5I GGATG 3 cut(s) 343, 534, 604
BstMAI GTCTC 3 cut(s) 40, 284, 305
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 429
BstNSI RCATGY 2 cut(s) 750, 754
BstSCI CCNGG 2 cut(s) 130, 427
BstV1I GCAGC 3 cut(s) 73, 184, 206
BstV2I GAAGAC 1 cut(s) 97
BsuRI GGCC 2 cut(s) 259, 525
BtsCI GGATG 3 cut(s) 343, 534, 604
BtsIMutI CAGTG 1 cut(s) 423
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 2 cut(s) 475, 754
CviAII CATG 5 cut(s) 385, 403, 659, 747, 751
CviQI GTAC 2 cut(s) 475, 754
DdeI CTNAG 7 cut(s) 22, 177, 218, 227, 349, 483, 497
DriI GACNNNNNGTC 1 cut(s) 297
Eam1104I CTCTTC 4 cut(s) 282, 543, 573, 582
Eam1105I GACNNNNNGTC 1 cut(s) 297
EarI CTCTTC 4 cut(s) 282, 543, 573, 582
Ecl136II GAGCTC 2 cut(s) 97, 137
Eco24I GRGCYC 2 cut(s) 99, 139
Eco32I GATATC 1 cut(s) 647
Eco47I GGWCC 1 cut(s) 128
Eco53kI GAGCTC 2 cut(s) 97, 137
EcoICRI GAGCTC 2 cut(s) 97, 137
EcoO109I RGGNCCY 1 cut(s) 128
EcoRII CCWGG 1 cut(s) 427
EcoRV GATATC 1 cut(s) 647
EcoT22I ATGCAT 1 cut(s) 752
EcoT38I GRGCYC 2 cut(s) 99, 139
FaeI CATG 5 cut(s) 388, 406, 662, 750, 754
FatI CATG 5 cut(s) 384, 402, 658, 746, 750
Fnu4HI GCNGC 3 cut(s) 87, 195, 198
FokI GGATG 3 cut(s) 350, 521, 611
FriOI GRGCYC 2 cut(s) 99, 139
Fsp4HI GCNGC 3 cut(s) 87, 195, 198
FspBI CTAG 3 cut(s) 59, 323, 642
GluI GCNGC 3 cut(s) 87, 195, 198
HaeIII GGCC 2 cut(s) 259, 525
HapII CCGG 1 cut(s) 132
Hin1II CATG 5 cut(s) 388, 406, 662, 750, 754
HindIII AAGCTT 1 cut(s) 394
HinfI GANTC 2 cut(s) 181, 313
HpaII CCGG 1 cut(s) 132
HphI GGTGA 2 cut(s) 400, 623
Hpy166II GTNNAC 2 cut(s) 235, 565
Hpy188I TCNGA 4 cut(s) 25, 81, 376, 484
Hpy188III TCNNGA 2 cut(s) 126, 642
Hpy8I GTNNAC 2 cut(s) 235, 565
HpyAV CCTTC 1 cut(s) 446
HpyCH4III ACNGT 1 cut(s) 418
HpyCH4IV ACGT 2 cut(s) 102, 684
HpyCH4V TGCA 3 cut(s) 89, 283, 750
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 7 cut(s) 22, 177, 218, 227, 349, 483, 497
HpySE526I ACGT 2 cut(s) 102, 684
Hsp92II CATG 5 cut(s) 388, 406, 662, 750, 754
LmnI GCTCC 2 cut(s) 134, 358
LpnPI CCDG 8 cut(s) 23, 111, 145, 414, 441, 504, 509, 702
Lsp1109I GCAGC 3 cut(s) 73, 184, 206
MaeI CTAG 3 cut(s) 59, 323, 642
MaeII ACGT 2 cut(s) 102, 684
MaeIII GTNAC 1 cut(s) 64
MboII GAAGA 5 cut(s) 97, 299, 560, 590, 599
MfeI CAATTG 1 cut(s) 90
MhlI GDGCHC 2 cut(s) 99, 139
MlyI GAGTC 1 cut(s) 307
MmeI TCCRAC 1 cut(s) 583
MnlI CCTC 7 cut(s) 47, 328, 544, 548, 574, 599, 602
Mph1103I ATGCAT 1 cut(s) 752
MseI TTAA 3 cut(s) 510, 557, 666
MslI CAYNNNNRTG 2 cut(s) 71, 657
MspA1I CMGCKG 1 cut(s) 197
MspI CCGG 1 cut(s) 132
MspR9I CCNGG 2 cut(s) 132, 429
MunI CAATTG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 429
MwoI GCNNNNNNNGC 1 cut(s) 83
NciI CCSGG 1 cut(s) 132
NlaIII CATG 5 cut(s) 388, 406, 662, 750, 754
NlaIV GGNNCC 2 cut(s) 130, 434
NmuCI GTSAC 1 cut(s) 64
NsiI ATGCAT 1 cut(s) 752
NspI RCATGY 2 cut(s) 750, 754
PfeI GAWTC 1 cut(s) 181
PkrI GCNGC 3 cut(s) 88, 196, 199
PleI GAGTC 1 cut(s) 307
PpsI GAGTC 1 cut(s) 307
PpuMI RGGWCCY 1 cut(s) 128
Psp124BI GAGCTC 2 cut(s) 99, 139
Psp1406I AACGTT 1 cut(s) 684
Psp5II RGGWCCY 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 427
PspGI CCWGG 1 cut(s) 427
PspN4I GGNNCC 2 cut(s) 130, 434
PspPI GGNCC 1 cut(s) 128
PspPPI RGGWCCY 1 cut(s) 128
PvuII CAGCTG 1 cut(s) 197
RsaI GTAC 2 cut(s) 476, 755
RsaNI GTAC 2 cut(s) 475, 754
RseI CAYNNNNRTG 2 cut(s) 71, 657
SacI GAGCTC 2 cut(s) 99, 139
SaqAI TTAA 3 cut(s) 510, 557, 666
SatI GCNGC 3 cut(s) 87, 195, 198
Sau96I GGNCC 1 cut(s) 128
ScaI AGTACT 1 cut(s) 476
SchI GAGTC 1 cut(s) 307
ScrFI CCNGG 2 cut(s) 132, 429
SduI GDGCHC 2 cut(s) 99, 139
SinI GGWCC 1 cut(s) 128
SmiMI CAYNNNNRTG 2 cut(s) 71, 657
SmlI CTYRAG 2 cut(s) 265, 693
SmoI CTYRAG 2 cut(s) 265, 693
SspMI CTAG 3 cut(s) 59, 323, 642
SstI GAGCTC 2 cut(s) 99, 139
StyD4I CCNGG 2 cut(s) 130, 427
TaaI ACNGT 1 cut(s) 418
TaiI ACGT 2 cut(s) 105, 687
TaqI TCGA 2 cut(s) 149, 540
TatI WGTACW 2 cut(s) 474, 753
TfiI GAWTC 1 cut(s) 181
Tru1I TTAA 3 cut(s) 510, 557, 666
Tru9I TTAA 3 cut(s) 510, 557, 666
TscAI CASTG 1 cut(s) 423
TseFI GTSAC 1 cut(s) 64
TseI GCWGC 3 cut(s) 86, 194, 197
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 647, 757
TspRI CASTG 1 cut(s) 423
VpaK11BI GGWCC 1 cut(s) 128
XapI RAATTY 4 cut(s) 46, 168, 202, 529
XbaI TCTAGA 1 cut(s) 641
XceI RCATGY 2 cut(s) 750, 754
XspI CTAG 3 cut(s) 59, 323, 642
ZrmI AGTACT 1 cut(s) 476
Zsp2I ATGCAT 1 cut(s) 752
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.