Rh5CG406400
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0000656
Physical Location & Seq
Forward (+)
54452916 .. 54453852
937 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG406400.1

Sequence Viewer

Length: 223 bp
ATGTTCGAGTTGATACCAAATGCAGAGTCCATTATGTTGAAGTGGGTGCTTCATAATTGGGACGATGATCTATGCAAGAAAATATTAGAACGTTGTTGGCAGGCATTACCTGAAATCGGGAAGGTGATAGTTGTGGAATTTGCATTACCCGAAATACTGGAGAAAACCACAGATTTAAAGAAAATACTGGCATTAGACATCATCATGATGAGTATTTTTTGTG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko00950 ko01100 ko01110 map00940 map00950 map01100 map01110
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

74

Amino Acids

8.66

Weight (kDa)

4.78

Isoelectric Point (pI)

36.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_2 PF00891 1 - 70 1.8e-16 O-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000656)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g09630 FvH4_3g13140 FvH4_3g13141 FvH4_3g13160 FvH4_3g13170 FvH4_6g14540
malus_domestica MD10G1257600.v1.1
prunus_persica Prupe.4G086200_v2.0.a1
pyrus_communis pycom05g25920 pycom10g21380
rosa_chinensis RchiOBHm_Chr5g0014991 RchiOBHm_Chr5g0046111 RchiOBHm_Chr5g0056661 RchiOBHm_Chr7g0209941 RchiOBHm_Chr7g0211601 RchiOBHm_Chr7g0228691
rosa_laevigata RLG00000002994 RLG00000003075 RLG00000032124 RLG00000032125 RLG00000032158 RLG00000034388 RLG00000034564 RLG00000035118
rosa_multiflora Rmu_sc0003162.1_g000007 Rmu_sc0003162.1_g000010 Rmu_sc0003760.1_g000034 Rmu_sc0004232.1_g000016 Rmu_sc0004232.1_g000017 Rmu_sc0004232.1_g000023 Rmu_sc0004889.1_g000017 Rmu_sc0008669.1_g000001 Rmu_sc0009240.1_g000017 Rmu_sc0009255.1_g000012 Rmu_sc0013112.1_g000007
rosa_roxburghii Rroxscaffold_1G00023690 Rroxscaffold_1G00035370 Rroxscaffold_1G00035380 Rroxscaffold_1G00061590 Rroxscaffold_1G00061940 Rroxscaffold_3G00230880 Rroxscaffold_3G00247690
rosa_rugosa Rorug05G0019200 Rorug05G0022400 Rorug05G0225700 Rorug05G0246400 Rorug05G0301100 Rorug07G0117600 Rorug07G0126200
rosa_samantha Rh5AG114200 Rh5AG114300 Rh5AG117800 Rh5BG111300 Rh5BG115000 Rh5BG314800 Rh5BG383300 Rh5CG126300 Rh5CG359500 Rh5CG406400 Rh5DG110100 Rh5DG110600 Rh5DG114500 Rh5DG396000 Rh5DG396100 Rh7AG251400 Rh7AG403800 Rh7BG246000 Rh7CG268200 Rh7DG258000 Rh7DG266400
rosa_wichuraiana Rw5G009920 Rw5G010150 Rw5G028650 Rw5G034830 Rw7G021330 Rw7G022120 Rw7G033560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 91
AcsI RAATTY 1 cut(s) 137
AfiI CCNNNNNNNGG 1 cut(s) 116
AgsI TTSAA 1 cut(s) 40
ApoI RAATTY 1 cut(s) 137
ArsI GACNNNNNNTTYG 2 cut(s) 11, 43
AsuHPI GGTGA 1 cut(s) 136
BpmI CTGGAG 1 cut(s) 179
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse1I ACTGG 2 cut(s) 162, 192
BseLI CCNNNNNNNGG 1 cut(s) 116
BseNI ACTGG 2 cut(s) 162, 192
BslFI GGGAC 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 116
BsmFI GGGAC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 67
BspHI TCATGA 1 cut(s) 204
BsrI ACTGG 2 cut(s) 162, 192
BssMI GATC 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 102
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 102
CciI TCATGA 1 cut(s) 204
CviAII CATG 1 cut(s) 205
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
DraI TTTAAA 1 cut(s) 177
FaeI CATG 1 cut(s) 208
FaiI YATR 4 cut(s) 35, 54, 73, 206
FaqI GGGAC 1 cut(s) 74
FatI CATG 1 cut(s) 204
GsuI CTGGAG 1 cut(s) 179
Hin1II CATG 1 cut(s) 208
HinfI GANTC 1 cut(s) 26
HphI GGTGA 1 cut(s) 136
Hpy188III TCNNGA 2 cut(s) 118, 205
HpyAV CCTTC 1 cut(s) 115
HpyCH4IV ACGT 1 cut(s) 91
HpyCH4V TGCA 3 cut(s) 23, 75, 143
HpySE526I ACGT 1 cut(s) 91
Hsp92II CATG 1 cut(s) 208
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 4 cut(s) 86, 123, 143, 173
MaeII ACGT 1 cut(s) 91
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MluCI AATT 2 cut(s) 55, 137
MlyI GAGTC 1 cut(s) 35
MseI TTAA 1 cut(s) 176
MslI CAYNNNNRTG 2 cut(s) 203, 206
NdeII GATC 1 cut(s) 67
NlaIII CATG 1 cut(s) 208
PagI TCATGA 1 cut(s) 204
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
Psp1406I AACGTT 1 cut(s) 91
RseI CAYNNNNRTG 2 cut(s) 203, 206
SaqAI TTAA 1 cut(s) 176
Sau3AI GATC 1 cut(s) 67
SchI GAGTC 1 cut(s) 35
SetI ASST 3 cut(s) 94, 112, 126
SgeI CNNG 9 cut(s) 19, 88, 113, 122, 130, 161, 170, 200, 217
SmiMI CAYNNNNRTG 2 cut(s) 203, 206
Sse9I AATT 2 cut(s) 55, 137
SspI AATATT 1 cut(s) 84
TaiI ACGT 1 cut(s) 94
TaqI TCGA 1 cut(s) 6
TasI AATT 2 cut(s) 55, 137
Tru1I TTAA 1 cut(s) 176
Tru9I TTAA 1 cut(s) 176
TspDTI ATGAA 1 cut(s) 41
XapI RAATTY 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.