Rh5DG396000
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
62184450 .. 62184725
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG396000.1

Sequence Viewer

Length: 276 bp
ATGGAAATCCAGAGAATTAGCTCAAAGGATTATGTATCTGCTTGGAATTTGGGTGGTCTAGTTGTCACTCAAATGGCTTTAAAAGTTGCAATCGAGCTCAATGTCTTCAATATCATTGCCAATTCAGGACCCAGAGCTCATCTCACATCAAAAGAAATTGTATCTCAAATCTCAAATAAAAATCCTAATGCAGCAGCTGCAAATTTGAAGCGAATACTAAGAGTTCTCAGTATTCATTCTCTGCTATCTGTATCTCAAAGGTCAAGCTCAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

9.93

Weight (kDa)

11.0

Isoelectric Point (pI)

49.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimerisation PF08100 21 - 87 3.7e-11 O-methyltransferase dimerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000656)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 46, 202
AgsI TTSAA 2 cut(s) 109, 208
AluBI AGCT 5 cut(s) 21, 97, 137, 197, 267
AluI AGCT 5 cut(s) 21, 97, 137, 197, 267
Alw21I GWGCWC 2 cut(s) 99, 139
AlwNI CAGNNNCTG 1 cut(s) 197
ApeKI GCWGC 3 cut(s) 191, 194, 197
ApoI RAATTY 2 cut(s) 46, 202
AspS9I GGNCC 1 cut(s) 128
AvaII GGWCC 1 cut(s) 128
BanII GRGCYC 2 cut(s) 99, 139
BbsI GAAGAC 1 cut(s) 97
Bbv12I GWGCWC 2 cut(s) 99, 139
BbvI GCAGC 3 cut(s) 184, 203, 206
BfaI CTAG 1 cut(s) 59
BisI GCNGC 3 cut(s) 192, 195, 198
BlsI GCNGC 3 cut(s) 193, 196, 199
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 130
BpiI GAAGAC 1 cut(s) 97
BplI GAGNNNNNCTC 2 cut(s) 126, 158
BpuEI CTTGAG 1 cut(s) 253
Bse3DI GCAATG 1 cut(s) 114
BseMI GCAATG 1 cut(s) 114
BseMII CTCAG 1 cut(s) 241
BseXI GCAGC 3 cut(s) 184, 203, 206
BsiHKAI GWGCWC 2 cut(s) 99, 139
Bsp1286I GDGCHC 2 cut(s) 99, 139
BspCNI CTCAG 1 cut(s) 240
BspLI GGNNCC 1 cut(s) 130
BsrDI GCAATG 1 cut(s) 114
BstAPI GCANNNNNTGC 1 cut(s) 197
BstDEI CTNAG 2 cut(s) 218, 227
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstV1I GCAGC 3 cut(s) 184, 203, 206
BstV2I GAAGAC 1 cut(s) 97
CaiI CAGNNNCTG 1 cut(s) 197
Cfr13I GGNCC 1 cut(s) 128
CviJI RGCY 6 cut(s) 21, 77, 97, 137, 197, 267
CviKI_1 RGCY 6 cut(s) 21, 77, 97, 137, 197, 267
DdeI CTNAG 2 cut(s) 218, 227
DraI TTTAAA 1 cut(s) 81
Ecl136II GAGCTC 2 cut(s) 97, 137
Eco24I GRGCYC 2 cut(s) 99, 139
Eco47I GGWCC 1 cut(s) 128
Eco53kI GAGCTC 2 cut(s) 97, 137
EcoICRI GAGCTC 2 cut(s) 97, 137
EcoO109I RGGNCCY 1 cut(s) 128
EcoT38I GRGCYC 2 cut(s) 99, 139
FaiI YATR 1 cut(s) 33
Fnu4HI GCNGC 3 cut(s) 192, 195, 198
FriOI GRGCYC 2 cut(s) 99, 139
Fsp4HI GCNGC 3 cut(s) 192, 195, 198
FspBI CTAG 1 cut(s) 59
GluI GCNGC 3 cut(s) 192, 195, 198
Hpy188III TCNNGA 2 cut(s) 10, 126
HpyCH4V TGCA 3 cut(s) 89, 191, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 2 cut(s) 218, 227
LpnPI CCDG 3 cut(s) 23, 111, 145
Lsp1109I GCAGC 3 cut(s) 184, 203, 206
MaeI CTAG 1 cut(s) 59
MaeIII GTNAC 1 cut(s) 64
MboII GAAGA 1 cut(s) 97
MhlI GDGCHC 2 cut(s) 99, 139
MluCI AATT 5 cut(s) 15, 46, 121, 156, 202
MseI TTAA 1 cut(s) 80
MslI CAYNNNNRTG 1 cut(s) 71
MspA1I CMGCKG 1 cut(s) 197
MwoI GCNNNNNNNGC 1 cut(s) 197
NlaIV GGNNCC 1 cut(s) 130
NmuCI GTSAC 1 cut(s) 64
PkrI GCNGC 3 cut(s) 193, 196, 199
PpuMI RGGWCCY 1 cut(s) 128
Psp124BI GAGCTC 2 cut(s) 99, 139
Psp5II RGGWCCY 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 130
PspPI GGNCC 1 cut(s) 128
PspPPI RGGWCCY 1 cut(s) 128
PstNI CAGNNNCTG 1 cut(s) 197
PvuII CAGCTG 1 cut(s) 197
RseI CAYNNNNRTG 1 cut(s) 71
SacI GAGCTC 2 cut(s) 99, 139
SaqAI TTAA 1 cut(s) 80
SatI GCNGC 3 cut(s) 192, 195, 198
Sau96I GGNCC 1 cut(s) 128
SduI GDGCHC 2 cut(s) 99, 139
SetI ASST 7 cut(s) 23, 99, 139, 199, 263, 269, 275
SgeI CNNG 6 cut(s) 22, 54, 71, 106, 138, 144
SinI GGWCC 1 cut(s) 128
SmiMI CAYNNNNRTG 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
Sse9I AATT 5 cut(s) 15, 46, 121, 156, 202
SspMI CTAG 1 cut(s) 59
SstI GAGCTC 2 cut(s) 99, 139
TaqI TCGA 1 cut(s) 93
TasI AATT 5 cut(s) 15, 46, 121, 156, 202
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TseFI GTSAC 1 cut(s) 64
TseI GCWGC 3 cut(s) 191, 194, 197
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 1 cut(s) 224
VpaK11BI GGWCC 1 cut(s) 128
XapI RAATTY 2 cut(s) 46, 202
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.