Rmu_sc0009255.1_g000012
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009255.1
OG0000656
Physical Location & Seq
Forward (+)
39436 .. 40032
597 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009255.1_g000012.1.cds

Sequence Viewer

Length: 468 bp
atggaaagtcatggaagtttagaaaatcatacttcagcttggggtttggcaaattccatcaccattcaaatgactctgagagctgcagttgaggtcaatgtgttcaacatcattgccaaatcaggtgccggagctcgtctgacatcaaaagaaattatttcaccaattcccaatacaaatccaactttagcatgtgagaatttggagcgaatcctcaaacttttgcgtgttcattctcttttatccacatctttaagaccaaaccctattgataagacaaagcaagaaacaagttatggatttgcaagccttttgtttaaactgatttatgcacataaaaagcaaattccgccaacatctcaaggcgatggaatcctggatatgattctcgagcctagccaggacatgctaactaatgagcaagctcaagctttggaagaaaatagagcagccttagaggcaaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00950 ko01110 map00950 map01110
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

155

Amino Acids

16.98

Weight (kDa)

6.07

Isoelectric Point (pI)

36.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000656)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g09630 FvH4_3g13140 FvH4_3g13141 FvH4_3g13160 FvH4_3g13170 FvH4_6g14540
malus_domestica MD10G1257600.v1.1
prunus_persica Prupe.4G086200_v2.0.a1
pyrus_communis pycom05g25920 pycom10g21380
rosa_chinensis RchiOBHm_Chr5g0014991 RchiOBHm_Chr5g0046111 RchiOBHm_Chr5g0056661 RchiOBHm_Chr7g0209941 RchiOBHm_Chr7g0211601 RchiOBHm_Chr7g0228691
rosa_laevigata RLG00000002994 RLG00000003075 RLG00000032124 RLG00000032125 RLG00000032158 RLG00000034388 RLG00000034564 RLG00000035118
rosa_multiflora Rmu_sc0003162.1_g000007 Rmu_sc0003162.1_g000010 Rmu_sc0003760.1_g000034 Rmu_sc0004232.1_g000016 Rmu_sc0004232.1_g000017 Rmu_sc0004232.1_g000023 Rmu_sc0004889.1_g000017 Rmu_sc0008669.1_g000001 Rmu_sc0009240.1_g000017 Rmu_sc0009255.1_g000012 Rmu_sc0013112.1_g000007
rosa_roxburghii Rroxscaffold_1G00023690 Rroxscaffold_1G00035370 Rroxscaffold_1G00035380 Rroxscaffold_1G00061590 Rroxscaffold_1G00061940 Rroxscaffold_3G00230880 Rroxscaffold_3G00247690
rosa_rugosa Rorug05G0019200 Rorug05G0022400 Rorug05G0225700 Rorug05G0246400 Rorug05G0301100 Rorug07G0117600 Rorug07G0126200
rosa_samantha Rh5AG114200 Rh5AG114300 Rh5AG117800 Rh5BG111300 Rh5BG115000 Rh5BG314800 Rh5BG383300 Rh5CG126300 Rh5CG359500 Rh5CG406400 Rh5DG110100 Rh5DG110600 Rh5DG114500 Rh5DG396000 Rh5DG396100 Rh7AG251400 Rh7AG403800 Rh7BG246000 Rh7CG268200 Rh7DG258000 Rh7DG266400
rosa_wichuraiana Rw5G009920 Rw5G010150 Rw5G028650 Rw5G034830 Rw7G021330 Rw7G022120 Rw7G033560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 125
AciI CCGC 1 cut(s) 350
AcsI RAATTY 3 cut(s) 52, 199, 345
AcuI CTGAAG 1 cut(s) 18
AgsI TTSAA 2 cut(s) 68, 106
AjnI CCWGG 2 cut(s) 375, 399
AluBI AGCT 5 cut(s) 38, 83, 134, 425, 431
AluI AGCT 5 cut(s) 38, 83, 134, 425, 431
Alw21I GWGCWC 1 cut(s) 136
Ama87I CYCGRG 1 cut(s) 389
ApeKI GCWGC 2 cut(s) 83, 449
ApoI RAATTY 3 cut(s) 52, 199, 345
AsuHPI GGTGA 2 cut(s) 52, 153
AvaI CYCGRG 1 cut(s) 389
BanI GGYRCC 1 cut(s) 125
BanII GRGCYC 1 cut(s) 136
Bbv12I GWGCWC 1 cut(s) 136
BbvI GCAGC 2 cut(s) 70, 461
BccI CCATC 2 cut(s) 65, 362
BciT130I CCWGG 2 cut(s) 377, 401
BfaI CTAG 1 cut(s) 396
BfmI CTRYAG 1 cut(s) 84
BglI GCCNNNNNGGC 1 cut(s) 458
BisI GCNGC 2 cut(s) 84, 450
BlsI GCNGC 2 cut(s) 85, 451
Bme1390I CCNGG 2 cut(s) 377, 401
BmeT110I CYCGRG 1 cut(s) 389
BmiI GGNNCC 1 cut(s) 127
BmrFI CCNGG 2 cut(s) 377, 401
BpuEI CTTGAG 2 cut(s) 345, 411
Bse3DI GCAATG 1 cut(s) 111
BseBI CCWGG 2 cut(s) 377, 401
BseMI GCAATG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 68
BseXI GCAGC 2 cut(s) 70, 461
BshNI GGYRCC 1 cut(s) 125
BsiHKAI GWGCWC 1 cut(s) 136
BsiHKCI CYCGRG 1 cut(s) 389
BsiSI CCGG 1 cut(s) 129
BsoBI CYCGRG 1 cut(s) 389
Bsp1286I GDGCHC 1 cut(s) 136
BspACI CCGC 1 cut(s) 350
BspCNI CTCAG 1 cut(s) 69
BspLI GGNNCC 1 cut(s) 127
BspMAI CTGCAG 1 cut(s) 88
BspT107I GGYRCC 1 cut(s) 125
BsrDI GCAATG 1 cut(s) 111
Bst2UI CCWGG 2 cut(s) 377, 401
BstC8I GCNNGC 2 cut(s) 307, 423
BstDEI CTNAG 2 cut(s) 77, 454
BstMWI GCNNNNNNNGC 2 cut(s) 349, 458
BstNI CCWGG 2 cut(s) 377, 401
BstNSI RCATGY 2 cut(s) 195, 409
BstSCI CCNGG 2 cut(s) 375, 399
BstSFI CTRYAG 1 cut(s) 84
BstV1I GCAGC 2 cut(s) 70, 461
BtgZI GCGATG 1 cut(s) 381
Cac8I GCNNGC 2 cut(s) 307, 423
CviAII CATG 3 cut(s) 11, 192, 406
CviJI RGCY 9 cut(s) 38, 83, 134, 309, 394, 399, 425, 431, 452
CviKI_1 RGCY 9 cut(s) 38, 83, 134, 309, 394, 399, 425, 431, 452
DdeI CTNAG 2 cut(s) 77, 454
DraI TTTAAA 1 cut(s) 319
EciI GGCGGA 1 cut(s) 339
Ecl136II GAGCTC 1 cut(s) 134
Eco24I GRGCYC 1 cut(s) 136
Eco53kI GAGCTC 1 cut(s) 134
Eco57I CTGAAG 1 cut(s) 18
Eco88I CYCGRG 1 cut(s) 389
EcoICRI GAGCTC 1 cut(s) 134
EcoRII CCWGG 2 cut(s) 375, 399
EcoT38I GRGCYC 1 cut(s) 136
FaeI CATG 3 cut(s) 14, 195, 409
FaiI YATR 8 cut(s) 12, 30, 193, 297, 330, 336, 383, 407
FatI CATG 3 cut(s) 10, 191, 405
Fnu4HI GCNGC 2 cut(s) 84, 450
FriOI GRGCYC 1 cut(s) 136
Fsp4HI GCNGC 2 cut(s) 84, 450
FspBI CTAG 1 cut(s) 396
GluI GCNGC 2 cut(s) 84, 450
HapII CCGG 1 cut(s) 129
Hin1II CATG 3 cut(s) 14, 195, 409
HindIII AAGCTT 1 cut(s) 429
HinfI GANTC 4 cut(s) 73, 210, 372, 385
HpaII CCGG 1 cut(s) 129
HphI GGTGA 2 cut(s) 52, 153
Hpy188I TCNGA 2 cut(s) 78, 141
Hpy188III TCNNGA 1 cut(s) 389
HpyCH4V TGCA 3 cut(s) 86, 305, 332
HpyF10VI GCNNNNNNNGC 2 cut(s) 349, 458
HpyF3I CTNAG 2 cut(s) 77, 454
Hsp92II CATG 3 cut(s) 14, 195, 409
LmnI GCTCC 2 cut(s) 131, 205
LpnPI CCDG 6 cut(s) 108, 142, 362, 386, 389, 413
Lsp1109I GCAGC 2 cut(s) 70, 461
MaeI CTAG 1 cut(s) 396
MboII GAAGA 1 cut(s) 449
MhlI GDGCHC 1 cut(s) 136
MluCI AATT 6 cut(s) 52, 153, 165, 199, 345, 463
MlyI GAGTC 1 cut(s) 67
MmeI TCCRAC 1 cut(s) 206
MnlI CCTC 3 cut(s) 85, 224, 451
MseI TTAA 2 cut(s) 254, 318
MslI CAYNNNNRTG 1 cut(s) 68
MspI CCGG 1 cut(s) 129
MspR9I CCNGG 2 cut(s) 377, 401
MssI GTTTAAAC 1 cut(s) 319
MvaI CCWGG 2 cut(s) 377, 401
MwoI GCNNNNNNNGC 2 cut(s) 349, 458
NlaIII CATG 3 cut(s) 14, 195, 409
NlaIV GGNNCC 1 cut(s) 127
NspI RCATGY 2 cut(s) 195, 409
PaeR7I CTCGAG 1 cut(s) 389
PfeI GAWTC 3 cut(s) 210, 372, 385
PfoI TCCNGGA 1 cut(s) 375
PkrI GCNGC 2 cut(s) 85, 451
PleI GAGTC 1 cut(s) 67
PmeI GTTTAAAC 1 cut(s) 319
PpsI GAGTC 1 cut(s) 67
Psp124BI GAGCTC 1 cut(s) 136
Psp6I CCWGG 2 cut(s) 375, 399
PspGI CCWGG 2 cut(s) 375, 399
PspN4I GGNNCC 1 cut(s) 127
PstI CTGCAG 1 cut(s) 88
RseI CAYNNNNRTG 1 cut(s) 68
SacI GAGCTC 1 cut(s) 136
SaqAI TTAA 2 cut(s) 254, 318
SatI GCNGC 2 cut(s) 84, 450
SchI GAGTC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 377, 401
SduI GDGCHC 1 cut(s) 136
SetI ASST 7 cut(s) 40, 85, 96, 127, 136, 427, 433
SfcI CTRYAG 1 cut(s) 84
Sfr274I CTCGAG 1 cut(s) 389
SlaI CTCGAG 1 cut(s) 389
SmiMI CAYNNNNRTG 1 cut(s) 68
SmlI CTYRAG 3 cut(s) 360, 389, 426
SmoI CTYRAG 3 cut(s) 360, 389, 426
Sse9I AATT 6 cut(s) 52, 153, 165, 199, 345, 463
SsiI CCGC 1 cut(s) 350
SspMI CTAG 1 cut(s) 396
SstI GAGCTC 1 cut(s) 136
StyD4I CCNGG 2 cut(s) 375, 399
TaqI TCGA 1 cut(s) 390
TasI AATT 6 cut(s) 52, 153, 165, 199, 345, 463
TfiI GAWTC 3 cut(s) 210, 372, 385
Tru1I TTAA 2 cut(s) 254, 318
Tru9I TTAA 2 cut(s) 254, 318
TseI GCWGC 2 cut(s) 83, 449
TspDTI ATGAA 1 cut(s) 221
XapI RAATTY 3 cut(s) 52, 199, 345
XceI RCATGY 2 cut(s) 195, 409
XhoI CTCGAG 1 cut(s) 389
XspI CTAG 1 cut(s) 396
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.