Rw7G022120
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Forward (+)
25943124 .. 25945117
1994 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G022120.1

Sequence Viewer

Length: 1092 bp
ATGGAAAACCAGAGAATTAGCTCAAAAAACTATGTCTCTGCTTGGAATTTGGGAGGTTTAGTTGTCACTCAGATGGCTCTAAAAGCTGCAATCGAACTCAATGTCTTCAATATCATAGCCAATTCAGGACCTGGTGCTCATCTCACATCGAAAGAAATTGTATCTCAAATCTCCACCATGAATCCAAATGTAGCAGCTGAGAATTTGAAGCGAATATTAAGAGTTCTAAGTGCGCATTCTTTGTTATCTATATCTCAAAGGCCAAGCTTAAATGGTAAGACAGAACTAGAAGAGACTTATGGTTTAACAAATGATACTCTTTGCCTAGTTCCAAATGAAGATGGAGTTTCCTTGGCTCCATATATTATCTTTGCTTCTGATATGACCCTTGTGAAAAGCTTGTCCATGCTCAAAGAAACAGTGCTTGAACCTGGGAGCATTCCTTTCAACAAGACTCATGGTGTGTCCATGTATGAGTACATGTCTGAGAAACCTGAGCTGAGCCAATTGTTTAATAAGGCTATGGGACAAAGTTCCATCCTTGATTTTGAAGAGGTGTTAAATGTTTACAAAGGTTTTGAAGAGGTAAAAGAGTTGATGGATGTTGCAGGAGGCACTGGAACTACAATTGCCAAAGTAGTATCTAGGTATCCACACATTCAAGGAATTAACTTCGATTTACCTAATGTTGTCGCTCAAGGAATTGCTAAATACCAAGCAGGTGTGAAACATGTTGGTGGAGATATGTTTGAGTTGATACCAAATGCACAGTCTATTATGTTGAAGCGGATACTTCATAATTGGGACGATGATCTATGTAAGAAAATATTAAAATGTTGTTGGGAAGCATTACCAGAAATCGGGAAGGTAATAGTTGTGGAGTTTGCAATACCAGAAATAGTGGAGAAAACCGCAGATTTGGAGAAAATAGTGACATTAGACATCATAATGATGGCTTATCACGGCAGTAAAGAACGAACAATTGCTGAGTTTGACTACCTATCGAAAGCTGCAGGATTCAGTGAAATGAAGATTTTTCCGATTTCACATGGTTGTTATGTTATGGAACTTCACAAAGTTAAAACATATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

363

Amino Acids

40.21

Weight (kDa)

5.66

Isoelectric Point (pI)

34.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimerisation PF08100 21 - 103 8.1e-11 O-methyltransferase dimerisation domain
Methyltransf_2 PF00891 136 - 341 7.4e-53 O-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000656)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 710
Acc16I TGCGCA 1 cut(s) 234
Acc36I ACCTGC 1 cut(s) 710
AciI CCGC 2 cut(s) 787, 912
AcsI RAATTY 2 cut(s) 46, 202
AfaI GTAC 1 cut(s) 479
AfiI CCNNNNNNNGG 1 cut(s) 860
AflIII ACRYGT 2 cut(s) 480, 730
AgsI TTSAA 8 cut(s) 109, 208, 428, 448, 551, 581, 662, 784
AjnI CCWGG 2 cut(s) 130, 430
AluBI AGCT 7 cut(s) 21, 86, 197, 267, 399, 499, 1010
AluI AGCT 7 cut(s) 21, 86, 197, 267, 399, 499, 1010
Alw21I GWGCWC 1 cut(s) 139
Alw26I GTCTC 2 cut(s) 40, 287
AlwNI CAGNNNCTG 1 cut(s) 131
AoxI GGCC 1 cut(s) 260
ApeKI GCWGC 3 cut(s) 86, 194, 1010
ApoI RAATTY 2 cut(s) 46, 202
ArsI GACNNNNNNTTYG 4 cut(s) 87, 119, 755, 787
AspLEI GCGC 1 cut(s) 235
AspS9I GGNCC 1 cut(s) 128
AvaII GGWCC 1 cut(s) 128
BbsI GAAGAC 1 cut(s) 97
Bbv12I GWGCWC 1 cut(s) 139
BbvI GCAGC 3 cut(s) 73, 206, 997
BccI CCATC 5 cut(s) 67, 335, 545, 592, 946
BceAI ACGGC 1 cut(s) 979
BciT130I CCWGG 2 cut(s) 132, 432
BciVI GTATCC 2 cut(s) 660, 783
BcoDI GTCTC 2 cut(s) 40, 287
BfaI CTAG 3 cut(s) 287, 326, 645
BfmI CTRYAG 1 cut(s) 1011
BfuAI ACCTGC 1 cut(s) 710
BfuI GTATCC 2 cut(s) 660, 783
BisI GCNGC 3 cut(s) 87, 195, 1011
BlpI GCTNAGC 1 cut(s) 500
BlsI GCNGC 3 cut(s) 88, 196, 1012
Bme1390I CCNGG 2 cut(s) 132, 432
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 357
BmrFI CCNGG 2 cut(s) 132, 432
BpiI GAAGAC 1 cut(s) 97
Bpu10I CCTNAGC 1 cut(s) 495
Bpu1102I GCTNAGC 1 cut(s) 500
BpuEI CTTGAG 1 cut(s) 681
BsaJI CCNNGG 2 cut(s) 351, 431
BsaXI ACNNNNNCTCC 2 cut(s) 45, 75
Bsc4I CCNNNNNNNGG 1 cut(s) 860
Bse1I ACTGG 1 cut(s) 622
BseBI CCWGG 2 cut(s) 132, 432
BseDI CCNNGG 2 cut(s) 351, 431
BseGI GGATG 2 cut(s) 537, 607
BseLI CCNNNNNNNGG 1 cut(s) 860
BseMII CTCAG 6 cut(s) 83, 189, 477, 486, 491, 978
BseNI ACTGG 1 cut(s) 622
BseXI GCAGC 3 cut(s) 73, 206, 997
BshFI GGCC 1 cut(s) 262
BsiHKAI GWGCWC 1 cut(s) 139
BslFI GGGAC 2 cut(s) 540, 818
BslI CCNNNNNNNGG 1 cut(s) 860
BsmAI GTCTC 2 cut(s) 40, 287
BsmFI GGGAC 2 cut(s) 540, 818
BsmI GAATGC 2 cut(s) 235, 438
BsnI GGCC 1 cut(s) 262
Bsp1286I GDGCHC 1 cut(s) 139
Bsp143I GATC 1 cut(s) 811
Bsp1720I GCTNAGC 1 cut(s) 500
BspACI CCGC 2 cut(s) 787, 912
BspANI GGCC 1 cut(s) 262
BspCNI CTCAG 6 cut(s) 82, 190, 478, 487, 492, 979
BspLI GGNNCC 1 cut(s) 357
BspMAI CTGCAG 1 cut(s) 1015
BspMI ACCTGC 1 cut(s) 710
BsrI ACTGG 1 cut(s) 622
BssECI CCNNGG 2 cut(s) 351, 431
BssMI GATC 1 cut(s) 811
BssT1I CCWWGG 1 cut(s) 351
Bst2UI CCWGG 2 cut(s) 132, 432
Bst4CI ACNGT 2 cut(s) 421, 771
Bst6I CTCTTC 3 cut(s) 285, 546, 576
BstDEI CTNAG 7 cut(s) 69, 198, 227, 486, 495, 500, 987
BstF5I GGATG 2 cut(s) 537, 607
BstHHI GCGC 1 cut(s) 235
BstKTI GATC 1 cut(s) 814
BstMAI GTCTC 2 cut(s) 40, 287
BstMBI GATC 1 cut(s) 811
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNI CCWGG 2 cut(s) 132, 432
BstNSI RCATGY 2 cut(s) 484, 734
BstSCI CCNGG 2 cut(s) 130, 430
BstSFI CTRYAG 1 cut(s) 1011
BstV1I GCAGC 3 cut(s) 73, 206, 997
BstV2I GAAGAC 1 cut(s) 97
BsuI GTATCC 2 cut(s) 660, 783
BsuRI GGCC 1 cut(s) 262
BtsCI GGATG 2 cut(s) 537, 607
BtsIMutI CAGTG 3 cut(s) 426, 615, 1027
BveI ACCTGC 1 cut(s) 710
CaiI CAGNNNCTG 1 cut(s) 131
CfoI GCGC 1 cut(s) 235
Cfr13I GGNCC 1 cut(s) 128
CsiI ACCWGGT 1 cut(s) 130
Csp6I GTAC 1 cut(s) 478
CviAII CATG 7 cut(s) 178, 406, 458, 469, 481, 731, 1049
CviQI GTAC 1 cut(s) 478
DdeI CTNAG 7 cut(s) 69, 198, 227, 486, 495, 500, 987
DpnI GATC 1 cut(s) 813
DpnII GATC 1 cut(s) 811
Eam1104I CTCTTC 3 cut(s) 285, 546, 576
EarI CTCTTC 3 cut(s) 285, 546, 576
Eco130I CCWWGG 1 cut(s) 351
Eco47I GGWCC 1 cut(s) 128
EcoO109I RGGNCCY 1 cut(s) 128
EcoRII CCWGG 2 cut(s) 130, 430
EcoT14I CCWWGG 1 cut(s) 351
ErhI CCWWGG 1 cut(s) 351
FaeI CATG 7 cut(s) 181, 409, 461, 472, 484, 734, 1052
FaqI GGGAC 2 cut(s) 540, 818
FatI CATG 7 cut(s) 177, 405, 457, 468, 480, 730, 1048
Fnu4HI GCNGC 3 cut(s) 87, 195, 1011
FokI GGATG 2 cut(s) 524, 614
Fsp4HI GCNGC 3 cut(s) 87, 195, 1011
FspAI RTGCGCAY 1 cut(s) 234
FspBI CTAG 3 cut(s) 287, 326, 645
FspI TGCGCA 1 cut(s) 234
GlaI GCGC 1 cut(s) 234
GluI GCNGC 3 cut(s) 87, 195, 1011
HaeIII GGCC 1 cut(s) 262
HhaI GCGC 1 cut(s) 235
Hin1II CATG 7 cut(s) 181, 409, 461, 472, 484, 734, 1052
Hin6I GCGC 1 cut(s) 233
HinP1I GCGC 1 cut(s) 233
HindIII AAGCTT 2 cut(s) 265, 397
HinfI GANTC 3 cut(s) 181, 454, 1017
Hpy166II GTNNAC 1 cut(s) 568
Hpy188I TCNGA 4 cut(s) 72, 379, 487, 1041
Hpy188III TCNNGA 2 cut(s) 126, 862
Hpy8I GTNNAC 1 cut(s) 568
HpyAV CCTTC 1 cut(s) 859
HpyCH4III ACNGT 2 cut(s) 421, 771
HpyCH4V TGCA 5 cut(s) 89, 608, 767, 887, 1013
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 7 cut(s) 69, 198, 227, 486, 495, 500, 987
Hsp92II CATG 7 cut(s) 181, 409, 461, 472, 484, 734, 1052
HspAI GCGC 1 cut(s) 233
Kzo9I GATC 1 cut(s) 811
LmnI GCTCC 2 cut(s) 361, 435
Lsp1109I GCAGC 3 cut(s) 73, 206, 997
MabI ACCWGGT 1 cut(s) 130
MaeI CTAG 3 cut(s) 287, 326, 645
MaeIII GTNAC 2 cut(s) 64, 931
MalI GATC 1 cut(s) 813
MboI GATC 1 cut(s) 811
MboII GAAGA 6 cut(s) 97, 302, 350, 563, 593, 1042
MfeI CAATTG 3 cut(s) 506, 627, 981
MhlI GDGCHC 1 cut(s) 139
MlyI GAGTC 1 cut(s) 448
MnlI CCTC 4 cut(s) 47, 547, 577, 605
MseI TTAA 8 cut(s) 218, 269, 305, 513, 560, 669, 830, 1080
MslI CAYNNNNRTG 4 cut(s) 71, 735, 947, 950
MspA1I CMGCKG 1 cut(s) 197
MspR9I CCNGG 2 cut(s) 132, 432
MunI CAATTG 3 cut(s) 506, 627, 981
Mva1269I GAATGC 2 cut(s) 235, 438
MvaI CCWGG 2 cut(s) 132, 432
MwoI GCNNNNNNNGC 1 cut(s) 83
NdeII GATC 1 cut(s) 811
NlaIII CATG 7 cut(s) 181, 409, 461, 472, 484, 734, 1052
NlaIV GGNNCC 1 cut(s) 357
NmuCI GTSAC 2 cut(s) 64, 931
NsbI TGCGCA 1 cut(s) 234
NspI RCATGY 2 cut(s) 484, 734
PaqCI CACCTGC 1 cut(s) 710
PciI ACATGT 2 cut(s) 480, 730
PctI GAATGC 2 cut(s) 235, 438
PfeI GAWTC 2 cut(s) 181, 1017
PkrI GCNGC 3 cut(s) 88, 196, 1012
PleI GAGTC 1 cut(s) 448
PpsI GAGTC 1 cut(s) 448
PpuMI RGGWCCY 1 cut(s) 128
PscI ACATGT 2 cut(s) 480, 730
Psp5II RGGWCCY 1 cut(s) 128
Psp6I CCWGG 2 cut(s) 130, 430
PspGI CCWGG 2 cut(s) 130, 430
PspN4I GGNNCC 1 cut(s) 357
PspPI GGNCC 1 cut(s) 128
PspPPI RGGWCCY 1 cut(s) 128
PstI CTGCAG 1 cut(s) 1015
PstNI CAGNNNCTG 1 cut(s) 131
PvuII CAGCTG 1 cut(s) 197
RsaI GTAC 1 cut(s) 479
RsaNI GTAC 1 cut(s) 478
RseI CAYNNNNRTG 4 cut(s) 71, 735, 947, 950
SaqAI TTAA 8 cut(s) 218, 269, 305, 513, 560, 669, 830, 1080
SatI GCNGC 3 cut(s) 87, 195, 1011
Sau3AI GATC 1 cut(s) 811
Sau96I GGNCC 1 cut(s) 128
SchI GAGTC 1 cut(s) 448
ScrFI CCNGG 2 cut(s) 132, 432
SduI GDGCHC 1 cut(s) 139
SexAI ACCWGGT 1 cut(s) 130
SfcI CTRYAG 1 cut(s) 1011
SinI GGWCC 1 cut(s) 128
SmiMI CAYNNNNRTG 4 cut(s) 71, 735, 947, 950
SmlI CTYRAG 1 cut(s) 696
SmoI CTYRAG 1 cut(s) 696
SsiI CCGC 2 cut(s) 787, 912
SspI AATATT 2 cut(s) 216, 828
SspMI CTAG 3 cut(s) 287, 326, 645
StyD4I CCNGG 2 cut(s) 130, 430
StyI CCWWGG 1 cut(s) 351
TaaI ACNGT 2 cut(s) 421, 771
TaqI TCGA 4 cut(s) 93, 149, 675, 1004
TatI WGTACW 1 cut(s) 477
TfiI GAWTC 2 cut(s) 181, 1017
Tru1I TTAA 8 cut(s) 218, 269, 305, 513, 560, 669, 830, 1080
Tru9I TTAA 8 cut(s) 218, 269, 305, 513, 560, 669, 830, 1080
TscAI CASTG 3 cut(s) 426, 622, 1027
TseFI GTSAC 2 cut(s) 64, 931
TseI GCWGC 3 cut(s) 86, 194, 1010
Tsp45I GTSAC 2 cut(s) 64, 931
TspDTI ATGAA 4 cut(s) 194, 351, 785, 1043
TspRI CASTG 3 cut(s) 426, 622, 1027
VpaK11BI GGWCC 1 cut(s) 128
XapI RAATTY 2 cut(s) 46, 202
XceI RCATGY 2 cut(s) 484, 734
XspI CTAG 3 cut(s) 287, 326, 645
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.