Rmu_sc0003162.1_g000010
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003162.1
Physical Location & Seq
Forward (+)
35995 .. 38178
2184 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003162.1_g000010.1.cds

Sequence Viewer

Length: 534 bp
atggaaagtcatggaagtttagaaaatcatacttcagcttggggtttggcaaattccatcaccattcaaatgactctgagagctgcagttgagctcaatgtgttcaacatcattgccaaatcaggtcccggagctcatctgacatcaaaagaaattgtttcacaaatccccaacccaaatccaactttagcaggtgaaaatctggagcgaatgctcaaacttttgagtgttcattctcttttatccacatctgtaagaccaaaccctactgatacgacaaagcaagaaacaagttatggtctaacaaaggaagcactttgcctagtcccgaataaagatggagtttcttttgctccggtttacaaaggtttcgaagaggtgaaggagctgatggatgtcggaggtggtgatggaactgcgattgccaagatagtgtctatgtatcctcacatccagggaatcaacttcaatttgccaagtgttgtatctaaagctcctgaattgcaaggtcagtatgtcaacatatttaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

177

Amino Acids

19.06

Weight (kDa)

6.19

Isoelectric Point (pI)

30.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000656)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 182
Acc36I ACCTGC 1 cut(s) 182
AcsI RAATTY 1 cut(s) 52
AcuI CTGAAG 1 cut(s) 18
AgsI TTSAA 3 cut(s) 68, 106, 469
AjnI CCWGG 1 cut(s) 453
AluBI AGCT 6 cut(s) 38, 83, 94, 134, 388, 494
AluI AGCT 6 cut(s) 38, 83, 94, 134, 388, 494
Alw21I GWGCWC 2 cut(s) 96, 136
ApeKI GCWGC 1 cut(s) 83
ApoI RAATTY 1 cut(s) 52
AspS9I GGNCC 1 cut(s) 125
AsuC2I CCSGG 1 cut(s) 129
AsuHPI GGTGA 4 cut(s) 52, 206, 391, 419
AsuII TTCGAA 1 cut(s) 372
AvaII GGWCC 1 cut(s) 125
BanII GRGCYC 2 cut(s) 96, 136
Bbv12I GWGCWC 2 cut(s) 96, 136
BbvI GCAGC 1 cut(s) 70
BccI CCATC 4 cut(s) 65, 332, 385, 404
BciT130I CCWGG 1 cut(s) 455
BciVI GTATCC 1 cut(s) 453
BcnI CCSGG 1 cut(s) 129
BfaI CTAG 1 cut(s) 323
BfmI CTRYAG 1 cut(s) 84
BfuAI ACCTGC 1 cut(s) 182
BfuI GTATCC 1 cut(s) 453
BisI GCNGC 1 cut(s) 84
BlsI GCNGC 1 cut(s) 85
Bme1390I CCNGG 2 cut(s) 129, 455
Bme18I GGWCC 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 125
BmiI GGNNCC 1 cut(s) 127
BmrFI CCNGG 2 cut(s) 129, 455
BpmI CTGGAG 1 cut(s) 224
Bpu14I TTCGAA 1 cut(s) 372
BpuMI CCSGG 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 454
BsaWI WCCGGW 1 cut(s) 355
Bse3DI GCAATG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 455
BseDI CCNNGG 1 cut(s) 454
BseGI GGATG 2 cut(s) 400, 450
BseMI GCAATG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 68
BseXI GCAGC 1 cut(s) 70
BsiHKAI GWGCWC 2 cut(s) 96, 136
BsiSI CCGG 2 cut(s) 129, 356
BslFI GGGAC 2 cut(s) 111, 311
BsmFI GGGAC 2 cut(s) 111, 311
BsmI GAATGC 1 cut(s) 216
Bsp119I TTCGAA 1 cut(s) 372
Bsp1286I GDGCHC 2 cut(s) 96, 136
BspCNI CTCAG 1 cut(s) 69
BspLI GGNNCC 1 cut(s) 127
BspMAI CTGCAG 1 cut(s) 88
BspMI ACCTGC 1 cut(s) 182
BspT104I TTCGAA 1 cut(s) 372
BsrDI GCAATG 1 cut(s) 111
BssECI CCNNGG 1 cut(s) 454
Bst2UI CCWGG 1 cut(s) 455
Bst6I CTCTTC 1 cut(s) 369
BstBI TTCGAA 1 cut(s) 372
BstDEI CTNAG 1 cut(s) 77
BstF5I GGATG 2 cut(s) 400, 450
BstNI CCWGG 1 cut(s) 455
BstSCI CCNGG 2 cut(s) 127, 453
BstSFI CTRYAG 1 cut(s) 84
BstV1I GCAGC 1 cut(s) 70
BsuI GTATCC 1 cut(s) 453
BtsCI GGATG 2 cut(s) 400, 450
BveI ACCTGC 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 125
CviAII CATG 1 cut(s) 11
CviJI RGCY 6 cut(s) 38, 83, 94, 134, 388, 494
CviKI_1 RGCY 6 cut(s) 38, 83, 94, 134, 388, 494
DdeI CTNAG 1 cut(s) 77
Eam1104I CTCTTC 1 cut(s) 369
EarI CTCTTC 1 cut(s) 369
Ecl136II GAGCTC 2 cut(s) 94, 134
Eco24I GRGCYC 2 cut(s) 96, 136
Eco47I GGWCC 1 cut(s) 125
Eco53kI GAGCTC 2 cut(s) 94, 134
Eco57I CTGAAG 1 cut(s) 18
EcoICRI GAGCTC 2 cut(s) 94, 134
EcoO109I RGGNCCY 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 453
EcoT38I GRGCYC 2 cut(s) 96, 136
FaeI CATG 1 cut(s) 14
FaiI YATR 6 cut(s) 12, 30, 297, 440, 516, 524
FaqI GGGAC 2 cut(s) 111, 311
FatI CATG 1 cut(s) 10
Fnu4HI GCNGC 1 cut(s) 84
FokI GGATG 2 cut(s) 407, 437
FriOI GRGCYC 2 cut(s) 96, 136
Fsp4HI GCNGC 1 cut(s) 84
FspBI CTAG 1 cut(s) 323
GluI GCNGC 1 cut(s) 84
GsuI CTGGAG 1 cut(s) 224
HapII CCGG 2 cut(s) 129, 356
Hin1II CATG 1 cut(s) 14
HincII GTYRAC 1 cut(s) 520
HindII GTYRAC 1 cut(s) 520
HinfI GANTC 2 cut(s) 73, 459
HpaII CCGG 2 cut(s) 129, 356
HphI GGTGA 4 cut(s) 52, 206, 391, 419
Hpy166II GTNNAC 2 cut(s) 361, 520
Hpy188I TCNGA 3 cut(s) 78, 141, 401
Hpy188III TCNNGA 3 cut(s) 203, 328, 497
Hpy8I GTNNAC 2 cut(s) 361, 520
HpyAV CCTTC 1 cut(s) 376
HpyCH4V TGCA 2 cut(s) 86, 505
HpyF3I CTNAG 1 cut(s) 77
Hsp92II CATG 1 cut(s) 14
LmnI GCTCC 5 cut(s) 131, 205, 358, 385, 499
LpnPI CCDG 8 cut(s) 108, 142, 177, 188, 369, 440, 467, 510
Lsp1109I GCAGC 1 cut(s) 70
MaeI CTAG 1 cut(s) 323
MboII GAAGA 1 cut(s) 386
MhlI GDGCHC 2 cut(s) 96, 136
MluCI AATT 4 cut(s) 52, 153, 469, 500
MlyI GAGTC 1 cut(s) 67
MmeI TCCRAC 2 cut(s) 206, 379
MnlI CCTC 3 cut(s) 370, 395, 456
MseI TTAA 1 cut(s) 528
MslI CAYNNNNRTG 1 cut(s) 68
MspI CCGG 2 cut(s) 129, 356
MspR9I CCNGG 2 cut(s) 129, 455
Mva1269I GAATGC 1 cut(s) 216
MvaI CCWGG 1 cut(s) 455
NciI CCSGG 1 cut(s) 129
NlaIII CATG 1 cut(s) 14
NlaIV GGNNCC 1 cut(s) 127
NspV TTCGAA 1 cut(s) 372
PaqCI CACCTGC 1 cut(s) 182
PctI GAATGC 1 cut(s) 216
PfeI GAWTC 1 cut(s) 459
PfoI TCCNGGA 1 cut(s) 127
PkrI GCNGC 1 cut(s) 85
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
PpuMI RGGWCCY 1 cut(s) 125
Psp124BI GAGCTC 2 cut(s) 96, 136
Psp5II RGGWCCY 1 cut(s) 125
Psp6I CCWGG 1 cut(s) 453
PspGI CCWGG 1 cut(s) 453
PspN4I GGNNCC 1 cut(s) 127
PspPI GGNCC 1 cut(s) 125
PspPPI RGGWCCY 1 cut(s) 125
PstI CTGCAG 1 cut(s) 88
RseI CAYNNNNRTG 1 cut(s) 68
SacI GAGCTC 2 cut(s) 96, 136
SaqAI TTAA 1 cut(s) 528
SatI GCNGC 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 125
SchI GAGTC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 129, 455
SduI GDGCHC 2 cut(s) 96, 136
SfcI CTRYAG 1 cut(s) 84
SfuI TTCGAA 1 cut(s) 372
SinI GGWCC 1 cut(s) 125
SmiMI CAYNNNNRTG 1 cut(s) 68
Sse9I AATT 4 cut(s) 52, 153, 469, 500
SspMI CTAG 1 cut(s) 323
SstI GAGCTC 2 cut(s) 96, 136
StyD4I CCNGG 2 cut(s) 127, 453
TaqI TCGA 1 cut(s) 372
TasI AATT 4 cut(s) 52, 153, 469, 500
TfiI GAWTC 1 cut(s) 459
Tru1I TTAA 1 cut(s) 528
Tru9I TTAA 1 cut(s) 528
TseI GCWGC 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 221
VpaK11BI GGWCC 1 cut(s) 125
XapI RAATTY 1 cut(s) 52
XspI CTAG 1 cut(s) 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.