Rmu_sc0004889.1_g000017
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004889.1
Physical Location & Seq
Forward (+)
68249 .. 68974
726 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004889.1_g000017.1.cds

Sequence Viewer

Length: 726 bp
atgggaaattcggtttgcattcaaatggctctaagagctgcaatagagctcgatgtcttcaatatcattgctaagtcagggccagaagctcatcttacatcaaaagaaattgtttcggcaatccccaccacaaacccaaatgtagcagctaagaatttagagcgaatccttaagcttcttagtgtcaattccctcctttctacctctctcaaaccaagcccaaatgacaaaacaccacaagaaagggcttatggcctaacaaaaaatgcactttgcctgctgccaaatgaagatggagtttctataacaccaatgattatgttgggctctgaaatgcacgttatgcagagcttatacatgctcaagcactcagtgcttgagccagagagtattcctttctctaaattctatggagaaaatttttatgaatacatgtcccagagaccagagacattttcattgttcaacaagctcatgagaacagcctcttatttatattttgatcagaaggtgcttaaggtttatcgaggttttgaagaagtgaaagagcttatagatgtagggggtggtgatggaagttcccttgcaaaaattgtgtctatgtatcctcacatccatggcatcaatttcaacttacctagtgttattgctcaagctcctaaatatcaaggtcatattttagaactatgtatactcacatatacatccaaaaatttcaaaatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

241

Amino Acids

26.9

Weight (kDa)

7.7

Isoelectric Point (pI)

42.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000656)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 691
AcsI RAATTY 6 cut(s) 7, 154, 404, 418, 712, 720
AdeI CACNNNGTG 1 cut(s) 373
AflII CTTAAG 2 cut(s) 170, 515
AflIII ACRYGT 1 cut(s) 432
AgsI TTSAA 6 cut(s) 23, 61, 466, 536, 631, 718
AluBI AGCT 9 cut(s) 38, 49, 89, 149, 175, 351, 472, 550, 656
AluI AGCT 9 cut(s) 38, 49, 89, 149, 175, 351, 472, 550, 656
Alw21I GWGCWC 1 cut(s) 51
Alw26I GTCTC 2 cut(s) 436, 443
AoxI GGCC 2 cut(s) 80, 253
ApeKI GCWGC 3 cut(s) 38, 146, 280
ApoI RAATTY 6 cut(s) 7, 154, 404, 418, 712, 720
ArsI GACNNNNNNTTYG 2 cut(s) 581, 613
AspS9I GGNCC 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 581
BanII GRGCYC 2 cut(s) 51, 329
BbsI GAAGAC 1 cut(s) 49
Bbv12I GWGCWC 1 cut(s) 51
BbvI GCAGC 3 cut(s) 25, 158, 267
BccI CCATC 2 cut(s) 287, 566
BciVI GTATCC 1 cut(s) 615
BclI TGATCA 1 cut(s) 502
BcoDI GTCTC 2 cut(s) 436, 443
BfaI CTAG 1 cut(s) 639
BfrI CTTAAG 2 cut(s) 170, 515
BfuI GTATCC 1 cut(s) 615
BisI GCNGC 3 cut(s) 39, 147, 281
BlsI GCNGC 3 cut(s) 40, 148, 282
BmgT120I GGNCC 1 cut(s) 80
BmsI GCATC 1 cut(s) 630
BpiI GAAGAC 1 cut(s) 49
BpuEI CTTGAG 3 cut(s) 347, 398, 636
BsaI GGTCTC 1 cut(s) 436
BsaJI CCNNGG 1 cut(s) 616
Bse3DI GCAATG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 616
BseGI GGATG 2 cut(s) 612, 704
BseMI GCAATG 1 cut(s) 66
BseMII CTCAG 1 cut(s) 384
BseXI GCAGC 3 cut(s) 25, 158, 267
BshFI GGCC 2 cut(s) 82, 255
BsiHKAI GWGCWC 1 cut(s) 51
BslFI GGGAC 1 cut(s) 421
BsmAI GTCTC 2 cut(s) 436, 443
BsmFI GGGAC 1 cut(s) 421
BsmI GAATGC 1 cut(s) 18
BsnI GGCC 2 cut(s) 82, 255
Bso31I GGTCTC 1 cut(s) 436
Bsp1286I GDGCHC 2 cut(s) 51, 329
Bsp143I GATC 1 cut(s) 502
Bsp19I CCATGG 1 cut(s) 616
BspANI GGCC 2 cut(s) 82, 255
BspCNI CTCAG 1 cut(s) 383
BspHI TCATGA 1 cut(s) 474
BspTI CTTAAG 2 cut(s) 170, 515
BspTNI GGTCTC 1 cut(s) 436
BsrDI GCAATG 1 cut(s) 66
BssECI CCNNGG 1 cut(s) 616
BssMI GATC 1 cut(s) 502
BssNAI GTATAC 1 cut(s) 692
BssT1I CCWWGG 1 cut(s) 616
Bst1107I GTATAC 1 cut(s) 692
BstAFI CTTAAG 2 cut(s) 170, 515
BstAPI GCANNNNNTGC 2 cut(s) 343, 373
BstC8I GCNNGC 1 cut(s) 278
BstDEI CTNAG 5 cut(s) 32, 72, 150, 179, 370
BstDSI CCRYGG 1 cut(s) 616
BstF5I GGATG 2 cut(s) 612, 704
BstKTI GATC 1 cut(s) 505
BstMAI GTCTC 2 cut(s) 436, 443
BstMBI GATC 1 cut(s) 502
BstMWI GCNNNNNNNGC 3 cut(s) 35, 343, 373
BstNSI RCATGY 2 cut(s) 361, 436
BstV1I GCAGC 3 cut(s) 25, 158, 267
BstV2I GAAGAC 1 cut(s) 49
BstZ17I GTATAC 1 cut(s) 692
BsuI GTATCC 1 cut(s) 615
BsuRI GGCC 2 cut(s) 82, 255
BtgI CCRYGG 1 cut(s) 616
BtsCI GGATG 2 cut(s) 612, 704
BtsIMutI CAGTG 1 cut(s) 378
Cac8I GCNNGC 1 cut(s) 278
CciI TCATGA 1 cut(s) 474
Cfr13I GGNCC 1 cut(s) 80
CviAII CATG 4 cut(s) 358, 433, 475, 617
DdeI CTNAG 5 cut(s) 32, 72, 150, 179, 370
DpnI GATC 1 cut(s) 504
DpnII GATC 1 cut(s) 502
DraIII CACNNNGTG 1 cut(s) 373
Ecl136II GAGCTC 1 cut(s) 49
Eco130I CCWWGG 1 cut(s) 616
Eco24I GRGCYC 2 cut(s) 51, 329
Eco31I GGTCTC 1 cut(s) 436
Eco53kI GAGCTC 1 cut(s) 49
EcoICRI GAGCTC 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 616
EcoT38I GRGCYC 2 cut(s) 51, 329
ErhI CCWWGG 1 cut(s) 616
FaeI CATG 4 cut(s) 361, 436, 478, 620
FalI AAGNNNNNCTT 2 cut(s) 78, 110
FaqI GGGAC 1 cut(s) 421
FatI CATG 4 cut(s) 357, 432, 474, 616
FbaI TGATCA 1 cut(s) 502
FblI GTMKAC 1 cut(s) 691
Fnu4HI GCNGC 3 cut(s) 39, 147, 281
FokI GGATG 2 cut(s) 599, 691
FriOI GRGCYC 2 cut(s) 51, 329
Fsp4HI GCNGC 3 cut(s) 39, 147, 281
FspBI CTAG 1 cut(s) 639
GluI GCNGC 3 cut(s) 39, 147, 281
HaeIII GGCC 2 cut(s) 82, 255
Hin1II CATG 4 cut(s) 361, 436, 478, 620
HindIII AAGCTT 1 cut(s) 173
HinfI GANTC 1 cut(s) 165
HphI GGTGA 1 cut(s) 581
Hpy166II GTNNAC 1 cut(s) 692
Hpy188I TCNGA 2 cut(s) 331, 507
Hpy188III TCNNGA 1 cut(s) 475
Hpy8I GTNNAC 1 cut(s) 692
HpyAV CCTTC 1 cut(s) 502
HpyCH4IV ACGT 1 cut(s) 339
HpyCH4V TGCA 6 cut(s) 18, 41, 269, 337, 346, 587
HpyF10VI GCNNNNNNNGC 3 cut(s) 35, 343, 373
HpyF3I CTNAG 5 cut(s) 32, 72, 150, 179, 370
HpySE526I ACGT 1 cut(s) 339
Hsp92II CATG 4 cut(s) 361, 436, 478, 620
Ksp22I TGATCA 1 cut(s) 502
Kzo9I GATC 1 cut(s) 502
LmnI GCTCC 1 cut(s) 661
LpnPI CCDG 6 cut(s) 63, 96, 290, 396, 452, 459
Lsp1109I GCAGC 3 cut(s) 25, 158, 267
LweI GCATC 1 cut(s) 630
MaeI CTAG 1 cut(s) 639
MaeII ACGT 1 cut(s) 339
MalI GATC 1 cut(s) 504
MboI GATC 1 cut(s) 502
MboII GAAGA 3 cut(s) 49, 302, 548
MhlI GDGCHC 2 cut(s) 51, 329
MnlI CCTC 5 cut(s) 203, 214, 496, 521, 618
MseI TTAA 2 cut(s) 171, 516
MslI CAYNNNNRTG 2 cut(s) 23, 615
MspCI CTTAAG 2 cut(s) 170, 515
Mva1269I GAATGC 1 cut(s) 18
MwoI GCNNNNNNNGC 3 cut(s) 35, 343, 373
NcoI CCATGG 1 cut(s) 616
NdeII GATC 1 cut(s) 502
NlaIII CATG 4 cut(s) 361, 436, 478, 620
NspI RCATGY 2 cut(s) 361, 436
PagI TCATGA 1 cut(s) 474
PciI ACATGT 1 cut(s) 432
PctI GAATGC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 165
PkrI GCNGC 3 cut(s) 40, 148, 282
PscI ACATGT 1 cut(s) 432
Psp124BI GAGCTC 1 cut(s) 51
PspPI GGNCC 1 cut(s) 80
PsrI GAACNNNNNNTAC 2 cut(s) 675, 707
RseI CAYNNNNRTG 2 cut(s) 23, 615
SacI GAGCTC 1 cut(s) 51
SaqAI TTAA 2 cut(s) 171, 516
SatI GCNGC 3 cut(s) 39, 147, 281
Sau3AI GATC 1 cut(s) 502
Sau96I GGNCC 1 cut(s) 80
SduI GDGCHC 2 cut(s) 51, 329
SfaNI GCATC 1 cut(s) 630
SmiMI CAYNNNNRTG 2 cut(s) 23, 615
SmlI CTYRAG 5 cut(s) 170, 362, 377, 515, 651
SmoI CTYRAG 5 cut(s) 170, 362, 377, 515, 651
SspMI CTAG 1 cut(s) 639
SstI GAGCTC 1 cut(s) 51
StyI CCWWGG 1 cut(s) 616
TaiI ACGT 1 cut(s) 342
TaqI TCGA 2 cut(s) 51, 526
TfiI GAWTC 1 cut(s) 165
Tru1I TTAA 2 cut(s) 171, 516
Tru9I TTAA 2 cut(s) 171, 516
TscAI CASTG 1 cut(s) 378
TseI GCWGC 3 cut(s) 38, 146, 280
TspDTI ATGAA 3 cut(s) 303, 441, 447
TspRI CASTG 1 cut(s) 378
Vha464I CTTAAG 2 cut(s) 170, 515
XapI RAATTY 6 cut(s) 7, 154, 404, 418, 712, 720
XceI RCATGY 2 cut(s) 361, 436
XmiI GTMKAC 1 cut(s) 691
XspI CTAG 1 cut(s) 639
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.