RchiOBHm_Chr2g0169051

OST-HTH/LOTUS domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
83340499 .. 83340984
486 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53668

Sequence Viewer

Length: 246 bp
ATGAGAATTGTATTGCTTCTTCTCAAGCATGGCGCTCTAGTAAGCCAAAGGAATAACTTGGGGTTGACAGAATTTCATATTGCTGCCAGTAATGGTAATTCTGAGGCCCTTGAGGTCCTTCTGTTGGAAGACCCAGATGGAGTGCATATAAGTGATGAAACTGAATGTATGCATTTGAACATTGTACTCAATGTAAGAACACAGACTTACCTGGAGTTGCAGCCATTGTTGAAGATTACAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.05

Weight (kDa)

4.96

Isoelectric Point (pI)

49.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 71
AfaI GTAC 1 cut(s) 186
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 2 cut(s) 178, 232
AjnI CCWGG 1 cut(s) 210
AoxI GGCC 1 cut(s) 105
ApeKI GCWGC 2 cut(s) 83, 220
ApoI RAATTY 1 cut(s) 71
AspLEI GCGC 1 cut(s) 35
AspS9I GGNCC 2 cut(s) 106, 115
AvaII GGWCC 1 cut(s) 115
BarI GAAGNNNNNNTAC 1 cut(s) 35
BbsI GAAGAC 1 cut(s) 135
BbvI GCAGC 2 cut(s) 70, 232
BccI CCATC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 212
BfaI CTAG 1 cut(s) 38
BfoI RGCGCY 1 cut(s) 36
BisI GCNGC 2 cut(s) 84, 221
BlsI GCNGC 2 cut(s) 85, 222
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 2 cut(s) 106, 115
BmrFI CCNGG 1 cut(s) 212
BpiI GAAGAC 1 cut(s) 135
BpmI CTGGAG 1 cut(s) 233
BpuEI CTTGAG 2 cut(s) 8, 131
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse1I ACTGG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 212
BseLI CCNNNNNNNGG 1 cut(s) 124
BseMII CTCAG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 87
BseXI GCAGC 2 cut(s) 70, 232
BshFI GGCC 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 124
BsnI GGCC 1 cut(s) 107
BspANI GGCC 1 cut(s) 107
BspCNI CTCAG 1 cut(s) 94
BsrI ACTGG 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 212
BstDEI CTNAG 1 cut(s) 102
BstH2I RGCGCY 1 cut(s) 36
BstHHI GCGC 1 cut(s) 35
BstNI CCWGG 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 210
BstV1I GCAGC 2 cut(s) 70, 232
BstV2I GAAGAC 1 cut(s) 135
BsuRI GGCC 1 cut(s) 107
CfoI GCGC 1 cut(s) 35
Cfr13I GGNCC 2 cut(s) 106, 115
Csp6I GTAC 1 cut(s) 185
CviAII CATG 1 cut(s) 29
CviJI RGCY 3 cut(s) 45, 107, 223
CviKI_1 RGCY 3 cut(s) 45, 107, 223
CviQI GTAC 1 cut(s) 185
DdeI CTNAG 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 115
EcoO109I RGGNCCY 2 cut(s) 106, 115
EcoRII CCWGG 1 cut(s) 210
EcoT22I ATGCAT 1 cut(s) 174
FaeI CATG 1 cut(s) 32
FaiI YATR 5 cut(s) 30, 78, 147, 149, 170
FatI CATG 1 cut(s) 28
Fnu4HI GCNGC 2 cut(s) 84, 221
Fsp4HI GCNGC 2 cut(s) 84, 221
FspBI CTAG 1 cut(s) 38
GlaI GCGC 1 cut(s) 34
GluI GCNGC 2 cut(s) 84, 221
GsuI CTGGAG 1 cut(s) 233
HaeII RGCGCY 1 cut(s) 36
HaeIII GGCC 1 cut(s) 107
HhaI GCGC 1 cut(s) 35
Hin1II CATG 1 cut(s) 32
Hin6I GCGC 1 cut(s) 33
HinP1I GCGC 1 cut(s) 33
HincII GTYRAC 1 cut(s) 66
HindII GTYRAC 1 cut(s) 66
Hpy166II GTNNAC 1 cut(s) 66
Hpy188I TCNGA 1 cut(s) 103
Hpy8I GTNNAC 1 cut(s) 66
HpyAV CCTTC 1 cut(s) 128
HpyCH4V TGCA 3 cut(s) 145, 172, 220
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 1 cut(s) 32
HspAI GCGC 1 cut(s) 33
LpnPI CCDG 4 cut(s) 100, 147, 197, 224
Lsp1109I GCAGC 2 cut(s) 70, 232
MaeI CTAG 1 cut(s) 38
MboII GAAGA 3 cut(s) 11, 140, 244
MluCI AATT 3 cut(s) 6, 71, 97
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 2 cut(s) 97, 106
Mph1103I ATGCAT 1 cut(s) 174
MslI CAYNNNNRTG 1 cut(s) 150
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
NlaIII CATG 1 cut(s) 32
NsiI ATGCAT 1 cut(s) 174
PkrI GCNGC 2 cut(s) 85, 222
PpuMI RGGWCCY 1 cut(s) 115
Psp5II RGGWCCY 1 cut(s) 115
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspPI GGNCC 2 cut(s) 106, 115
PspPPI RGGWCCY 1 cut(s) 115
RsaI GTAC 1 cut(s) 186
RsaNI GTAC 1 cut(s) 185
RseI CAYNNNNRTG 1 cut(s) 150
SatI GCNGC 2 cut(s) 84, 221
Sau96I GGNCC 2 cut(s) 106, 115
ScrFI CCNGG 1 cut(s) 212
SetI ASST 2 cut(s) 117, 213
SgeI CNNG 9 cut(s) 37, 41, 50, 70, 99, 122, 146, 223, 224
SinI GGWCC 1 cut(s) 115
SmiMI CAYNNNNRTG 1 cut(s) 150
SmlI CTYRAG 2 cut(s) 23, 110
SmoI CTYRAG 2 cut(s) 23, 110
Sse9I AATT 3 cut(s) 6, 71, 97
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 1 cut(s) 210
TasI AATT 3 cut(s) 6, 71, 97
TatI WGTACW 1 cut(s) 184
TseI GCWGC 2 cut(s) 83, 220
TspDTI ATGAA 2 cut(s) 65, 171
VpaK11BI GGWCC 1 cut(s) 115
XapI RAATTY 1 cut(s) 71
XspI CTAG 1 cut(s) 38
Zsp2I ATGCAT 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.