Rmu_ssc0000393.1_g000027

OST-HTH/LOTUS domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000393.1
OG0000679
Physical Location & Seq
Forward (+)
165229 .. 166116
888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000393.1_g000027.1.cds

Sequence Viewer

Length: 528 bp
atgcgttacatagtgctgaatccaaccactattagccttattgatcatgccttccccaatcaatttgaatgtatggctctggagttggcagatgaagacaccactaccaaaagttctcatgtttctacccctgtgaatgctagaaatgttaactcaaacaccaaggcagaggtttgtaagttcttcaaccctcatcaaggatgtgtcaggggagcaaagtgctttaatgcacattgggaggagtgtcagaaagtgaaggaggaagcagactggaatcattcttctgctgctaaactaaaacgcaaagtctttgttggaggacttcctctttcagtggactctgatgctttgggaaagctctgtgaaaaagagtttagatcggtggaagatgctatagttattgtaactcgaattgaaaacaagatacaatctcgaggctttggatttgtcacatttagagaggagaaatctgcttcggaagccatacaagcgcactacatcaccacgagggcaagaaagttgaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Ank_2 Ank_4 OST-HTH RRM_1

Protein Analysis

175

Amino Acids

19.71

Weight (kDa)

8.52

Isoelectric Point (pI)

34.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 197
AgsI TTSAA 4 cut(s) 68, 187, 416, 523
AluBI AGCT 1 cut(s) 358
AluI AGCT 1 cut(s) 358
Ama87I CYCGRG 1 cut(s) 432
ApeKI GCWGC 1 cut(s) 287
AspLEI GCGC 1 cut(s) 493
AsuHPI GGTGA 1 cut(s) 493
AvaI CYCGRG 1 cut(s) 432
BauI CACGAG 1 cut(s) 505
BbsI GAAGAC 1 cut(s) 102
BbvI GCAGC 1 cut(s) 274
BclI TGATCA 1 cut(s) 43
BfaI CTAG 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 393
BisI GCNGC 1 cut(s) 288
BlsI GCNGC 1 cut(s) 289
BmeT110I CYCGRG 1 cut(s) 432
BmsI GCATC 2 cut(s) 334, 379
BpiI GAAGAC 1 cut(s) 102
BpmI CTGGAG 1 cut(s) 101
BsaJI CCNNGG 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 197
Bse1I ACTGG 1 cut(s) 275
BseDI CCNNGG 1 cut(s) 162
BseGI GGATG 1 cut(s) 206
BseLI CCNNNNNNNGG 1 cut(s) 197
BseNI ACTGG 1 cut(s) 275
BseRI GAGGAG 2 cut(s) 254, 476
BseXI GCAGC 1 cut(s) 274
BsiHKCI CYCGRG 1 cut(s) 432
BslI CCNNNNNNNGG 1 cut(s) 197
BsmI GAATGC 1 cut(s) 142
BsoBI CYCGRG 1 cut(s) 432
Bsp143I GATC 2 cut(s) 43, 377
BsrI ACTGG 1 cut(s) 275
BssECI CCNNGG 1 cut(s) 162
BssMI GATC 2 cut(s) 43, 377
BssSI CACGAG 1 cut(s) 505
BssT1I CCWWGG 1 cut(s) 162
Bst2BI CACGAG 1 cut(s) 505
BstENI CCTNNNNNAGG 1 cut(s) 195
BstF5I GGATG 1 cut(s) 206
BstHHI GCGC 1 cut(s) 493
BstKTI GATC 2 cut(s) 46, 380
BstMBI GATC 2 cut(s) 43, 377
BstMWI GCNNNNNNNGC 2 cut(s) 479, 488
BstSFI CTRYAG 1 cut(s) 393
BstV1I GCAGC 1 cut(s) 274
BstV2I GAAGAC 1 cut(s) 102
BtsCI GGATG 1 cut(s) 206
BtsIMutI CAGTG 1 cut(s) 339
CfoI GCGC 1 cut(s) 493
CviAII CATG 2 cut(s) 47, 119
CviJI RGCY 5 cut(s) 36, 77, 358, 438, 482
CviKI_1 RGCY 5 cut(s) 36, 77, 358, 438, 482
DpnI GATC 2 cut(s) 45, 379
DpnII GATC 2 cut(s) 43, 377
Eco130I CCWWGG 1 cut(s) 162
Eco88I CYCGRG 1 cut(s) 432
EcoNI CCTNNNNNAGG 1 cut(s) 195
EcoT14I CCWWGG 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 162
FaeI CATG 2 cut(s) 50, 122
FaiI YATR 6 cut(s) 11, 48, 74, 120, 395, 485
FatI CATG 2 cut(s) 46, 118
FbaI TGATCA 1 cut(s) 43
Fnu4HI GCNGC 1 cut(s) 288
FokI GGATG 1 cut(s) 213
Fsp4HI GCNGC 1 cut(s) 288
FspBI CTAG 1 cut(s) 141
GlaI GCGC 1 cut(s) 492
GluI GCNGC 1 cut(s) 288
GsuI CTGGAG 1 cut(s) 101
HhaI GCGC 1 cut(s) 493
Hin1II CATG 2 cut(s) 50, 122
Hin6I GCGC 1 cut(s) 491
HinP1I GCGC 1 cut(s) 491
HincII GTYRAC 1 cut(s) 151
HindII GTYRAC 1 cut(s) 151
HinfI GANTC 3 cut(s) 19, 274, 338
HpaI GTTAAC 1 cut(s) 151
HphI GGTGA 1 cut(s) 493
Hpy166II GTNNAC 2 cut(s) 151, 337
Hpy188I TCNGA 3 cut(s) 249, 343, 478
Hpy188III TCNNGA 2 cut(s) 80, 432
Hpy8I GTNNAC 2 cut(s) 151, 337
HpyAV CCTTC 2 cut(s) 61, 250
HpyCH4V TGCA 1 cut(s) 230
HpyF10VI GCNNNNNNNGC 2 cut(s) 479, 488
Hsp92II CATG 2 cut(s) 50, 122
HspAI GCGC 1 cut(s) 491
Ksp22I TGATCA 1 cut(s) 43
KspAI GTTAAC 1 cut(s) 151
Kzo9I GATC 2 cut(s) 43, 377
LmnI GCTCC 1 cut(s) 212
LpnPI CCDG 4 cut(s) 65, 144, 193, 256
Lsp1109I GCAGC 1 cut(s) 274
LweI GCATC 2 cut(s) 334, 379
MaeI CTAG 1 cut(s) 141
MaeIII GTNAC 3 cut(s) 5, 403, 448
MalI GATC 2 cut(s) 45, 379
MboI GATC 2 cut(s) 43, 377
MboII GAAGA 4 cut(s) 107, 175, 273, 398
MluCI AATT 2 cut(s) 62, 411
MlyI GAGTC 1 cut(s) 332
MmeI TCCRAC 2 cut(s) 47, 295
MnlI CCTC 9 cut(s) 163, 201, 232, 253, 311, 336, 428, 454, 501
MseI TTAA 2 cut(s) 150, 225
Mva1269I GAATGC 1 cut(s) 142
MwoI GCNNNNNNNGC 2 cut(s) 479, 488
NdeII GATC 2 cut(s) 43, 377
NlaIII CATG 2 cut(s) 50, 122
NmuCI GTSAC 1 cut(s) 448
PaeR7I CTCGAG 1 cut(s) 432
PctI GAATGC 1 cut(s) 142
PfeI GAWTC 2 cut(s) 19, 274
PkrI GCNGC 1 cut(s) 289
PleI GAGTC 1 cut(s) 332
PpsI GAGTC 1 cut(s) 332
SaqAI TTAA 2 cut(s) 150, 225
SatI GCNGC 1 cut(s) 288
Sau3AI GATC 2 cut(s) 43, 377
SchI GAGTC 1 cut(s) 332
SetI ASST 2 cut(s) 174, 360
SfaNI GCATC 2 cut(s) 334, 379
SfcI CTRYAG 1 cut(s) 393
Sfr274I CTCGAG 1 cut(s) 432
SlaI CTCGAG 1 cut(s) 432
SmlI CTYRAG 1 cut(s) 432
SmoI CTYRAG 1 cut(s) 432
Sse9I AATT 2 cut(s) 62, 411
SspMI CTAG 1 cut(s) 141
StyI CCWWGG 1 cut(s) 162
TaqI TCGA 2 cut(s) 409, 433
TasI AATT 2 cut(s) 62, 411
TfiI GAWTC 2 cut(s) 19, 274
Tru1I TTAA 2 cut(s) 150, 225
Tru9I TTAA 2 cut(s) 150, 225
TscAI CASTG 1 cut(s) 339
TseFI GTSAC 1 cut(s) 448
TseI GCWGC 1 cut(s) 287
Tsp45I GTSAC 1 cut(s) 448
TspDTI ATGAA 1 cut(s) 108
TspRI CASTG 1 cut(s) 339
XagI CCTNNNNNAGG 1 cut(s) 195
XhoI CTCGAG 1 cut(s) 432
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.