RLG00000021799

ankyrin repeats

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Reverse (-)
78385844 .. 78387603
1760 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000021799

Sequence Viewer

Length: 468 bp
ATGAGAGGCAAGAAAGTTGAAATAAAAAGTTTAATTCCAAAATTGGTTTTGGGAGCTGAGTTTGAGAAGATGTCACCTCAACAACGACAACAAGAGAAGAATATTCAAAATCAGCTTCCACAGCAGAAGTCGAATGAGAATATTATGGAAGGTGATAACCCTGAACAAGGTTCTTGGGCTGATAGATTAGTCCTCGGACAACCAGTGGCGTGTTCCACTGAACCTCAAGTTACCAAGAACTCTGAGGATCCAAGCACTCCTACATGGCTAAAGGTTTTCAAGAAGTGGTTTCCTGGGTTCTTACAAGGTCTGTCAAAGCATTCAAATTATCCTCTGGATCCAAGACGGCATCTCGTTTTGGAGTCCCTGTCCAAGAAATGGAGCAAATCCTACTTCCTTCGTGAATTTGATTTCTACAAGTCCGGCCTAGATTTTGAGCCGACTAGCACCACTGTCACAATAGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

156

Amino Acids

17.87

Weight (kDa)

9.16

Isoelectric Point (pI)

52.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 378
AclWI GGATC 4 cut(s) 242, 255, 332, 345
AcsI RAATTY 1 cut(s) 404
AfiI CCNNNNNNNGG 2 cut(s) 167, 378
AgsI TTSAA 4 cut(s) 20, 107, 280, 324
AjnI CCWGG 1 cut(s) 292
AleI CACNNNNGTG 1 cut(s) 461
AluBI AGCT 2 cut(s) 56, 115
AluI AGCT 2 cut(s) 56, 115
AlwI GGATC 4 cut(s) 242, 255, 332, 345
AoxI GGCC 1 cut(s) 424
ApoI RAATTY 1 cut(s) 404
AsuHPI GGTGA 2 cut(s) 66, 164
BamHI GGATCC 2 cut(s) 247, 337
BceAI ACGGC 1 cut(s) 362
BciT130I CCWGG 1 cut(s) 294
BfaI CTAG 2 cut(s) 428, 444
Bme1390I CCNGG 1 cut(s) 294
BmiI GGNNCC 2 cut(s) 249, 339
BmrFI CCNGG 1 cut(s) 294
BmsI GCATC 1 cut(s) 358
BpuEI CTTGAG 1 cut(s) 210
BsaJI CCNNGG 2 cut(s) 193, 293
BsaXI ACNNNNNCTCC 2 cut(s) 353, 383
Bsc4I CCNNNNNNNGG 2 cut(s) 167, 378
Bse1I ACTGG 1 cut(s) 203
BseBI CCWGG 1 cut(s) 294
BseDI CCNNGG 2 cut(s) 193, 293
BseLI CCNNNNNNNGG 2 cut(s) 167, 378
BseMII CTCAG 2 cut(s) 48, 234
BseNI ACTGG 1 cut(s) 203
BshFI GGCC 1 cut(s) 426
BsiSI CCGG 1 cut(s) 423
BslFI GGGAC 1 cut(s) 349
BslI CCNNNNNNNGG 2 cut(s) 167, 378
BsmFI GGGAC 1 cut(s) 349
BsmI GAATGC 1 cut(s) 319
BsnI GGCC 1 cut(s) 426
Bsp143I GATC 2 cut(s) 247, 337
BspANI GGCC 1 cut(s) 426
BspCNI CTCAG 2 cut(s) 49, 235
BspLI GGNNCC 2 cut(s) 249, 339
BspPI GGATC 4 cut(s) 242, 255, 332, 345
BsrI ACTGG 1 cut(s) 203
BssECI CCNNGG 2 cut(s) 193, 293
BssMI GATC 2 cut(s) 247, 337
Bst2UI CCWGG 1 cut(s) 294
Bst4CI ACNGT 1 cut(s) 454
BstDEI CTNAG 2 cut(s) 57, 243
BstENI CCTNNNNNAGG 1 cut(s) 165
BstKTI GATC 2 cut(s) 250, 340
BstMBI GATC 2 cut(s) 247, 337
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNI CCWGG 1 cut(s) 294
BstSCI CCNGG 1 cut(s) 292
BstX2I RGATCY 2 cut(s) 247, 337
BstYI RGATCY 2 cut(s) 247, 337
BsuRI GGCC 1 cut(s) 426
BtsIMutI CAGTG 3 cut(s) 210, 216, 450
CviAII CATG 1 cut(s) 264
CviJI RGCY 6 cut(s) 56, 115, 179, 268, 426, 439
CviKI_1 RGCY 6 cut(s) 56, 115, 179, 268, 426, 439
DdeI CTNAG 2 cut(s) 57, 243
DpnI GATC 2 cut(s) 249, 339
DpnII GATC 2 cut(s) 247, 337
EcoNI CCTNNNNNAGG 1 cut(s) 165
EcoRII CCWGG 1 cut(s) 292
FaeI CATG 1 cut(s) 267
FaiI YATR 2 cut(s) 146, 265
FaqI GGGAC 1 cut(s) 349
FatI CATG 1 cut(s) 263
FspBI CTAG 2 cut(s) 428, 444
HaeIII GGCC 1 cut(s) 426
HapII CCGG 1 cut(s) 423
Hin1II CATG 1 cut(s) 267
HinfI GANTC 1 cut(s) 362
HpaII CCGG 1 cut(s) 423
HphI GGTGA 2 cut(s) 66, 164
Hpy188I TCNGA 2 cut(s) 197, 244
Hpy188III TCNNGA 3 cut(s) 280, 335, 401
HpyAV CCTTC 2 cut(s) 143, 407
HpyCH4III ACNGT 1 cut(s) 454
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
HpyF3I CTNAG 2 cut(s) 57, 243
Hsp92II CATG 1 cut(s) 267
Kzo9I GATC 2 cut(s) 247, 337
LmnI GCTCC 2 cut(s) 53, 381
LpnPI CCDG 7 cut(s) 174, 216, 279, 306, 320, 380, 436
LweI GCATC 1 cut(s) 358
MaeI CTAG 2 cut(s) 428, 444
MaeIII GTNAC 3 cut(s) 72, 229, 454
MalI GATC 2 cut(s) 249, 339
MboI GATC 2 cut(s) 247, 337
MboII GAAGA 2 cut(s) 79, 109
MflI RGATCY 2 cut(s) 247, 337
MluCI AATT 4 cut(s) 33, 41, 325, 404
MlyI GAGTC 1 cut(s) 371
MnlI CCTC 5 cut(s) 87, 203, 234, 238, 342
MseI TTAA 1 cut(s) 32
MslI CAYNNNNRTG 1 cut(s) 461
MspI CCGG 1 cut(s) 423
MspR9I CCNGG 1 cut(s) 294
Mva1269I GAATGC 1 cut(s) 319
MvaI CCWGG 1 cut(s) 294
MwoI GCNNNNNNNGC 1 cut(s) 121
NdeII GATC 2 cut(s) 247, 337
NlaIII CATG 1 cut(s) 267
NlaIV GGNNCC 2 cut(s) 249, 339
NmuCI GTSAC 2 cut(s) 72, 454
OliI CACNNNNGTG 1 cut(s) 461
PctI GAATGC 1 cut(s) 319
PflMI CCANNNNNTGG 1 cut(s) 378
PleI GAGTC 1 cut(s) 370
PpsI GAGTC 1 cut(s) 370
Psp6I CCWGG 1 cut(s) 292
PspGI CCWGG 1 cut(s) 292
PspN4I GGNNCC 2 cut(s) 249, 339
PsuI RGATCY 2 cut(s) 247, 337
RseI CAYNNNNRTG 1 cut(s) 461
SaqAI TTAA 1 cut(s) 32
Sau3AI GATC 2 cut(s) 247, 337
SchI GAGTC 1 cut(s) 371
ScrFI CCNGG 1 cut(s) 294
SetI ASST 8 cut(s) 58, 79, 117, 154, 172, 226, 276, 310
SfaNI GCATC 1 cut(s) 358
SmiMI CAYNNNNRTG 1 cut(s) 461
SmlI CTYRAG 1 cut(s) 225
SmoI CTYRAG 1 cut(s) 225
Sse9I AATT 4 cut(s) 33, 41, 325, 404
SspI AATATT 2 cut(s) 103, 142
SspMI CTAG 2 cut(s) 428, 444
StyD4I CCNGG 1 cut(s) 292
TaaI ACNGT 1 cut(s) 454
TaqI TCGA 1 cut(s) 131
TasI AATT 4 cut(s) 33, 41, 325, 404
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TscAI CASTG 3 cut(s) 210, 223, 457
TseFI GTSAC 2 cut(s) 72, 454
Tsp45I GTSAC 2 cut(s) 72, 454
TspRI CASTG 3 cut(s) 210, 223, 457
Van91I CCANNNNNTGG 1 cut(s) 378
XagI CCTNNNNNAGG 1 cut(s) 165
XapI RAATTY 1 cut(s) 404
XspI CTAG 2 cut(s) 428, 444
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.