Rmu_sc0032865.1_g000001

OST-HTH/LOTUS domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032865.1
Physical Location & Seq
Forward (+)
506 .. 1280
775 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032865.1_g000001.1.cds

Sequence Viewer

Length: 693 bp
atgtcacctcaaccacaagatcaagagaagagttttcaataccagcttccactgcagaagccgaacgagaatattgtggaaggtgataaccctgaacaaagttcttgggctgatagattagtccttaaacaaccagcagattgttccattgaacctcaagcacatgttaccaagagctctgaggacccaagcactcctacatggctaaaggttttcaacaagtggtttcctgggttcttacaaggtctgtcaaagcattcaaattatgctctctcttctctaaaagctgacttcaaggctaaatttgggttagaactggatcactcatctgtgggctactctaagctcagagacttcctgaagcgtgtctctgatttatgtaccatcgaggttctccccatatgcaaacatggaactccaactcacatgatcctccgtccaaaattttctagtcctcaatgccgcctccttcctacactcagaacaactcacactgatcttcagaacctttcaactgacagcggtagtgatgagaagtgtctccaggaccttccaactgacaatgctgttgattcaaagtgccttcaggacctttcacttgattctggtggtgattcagagtgtgttggagacgaaatgtatggctcaagtgtcactagccatggggaacctcctctgggtatcctgaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

230

Amino Acids

25.51

Weight (kDa)

5.34

Isoelectric Point (pI)

62.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 463, 522
AclWI GGATC 2 cut(s) 327, 424
AcsI RAATTY 2 cut(s) 302, 443
AcuI CTGAAG 3 cut(s) 380, 485, 569
AfaI GTAC 1 cut(s) 382
AfiI CCNNNNNNNGG 1 cut(s) 677
AflIII ACRYGT 1 cut(s) 163
AgsI TTSAA 7 cut(s) 38, 152, 217, 261, 295, 513, 576
AjnI CCWGG 2 cut(s) 229, 543
AluBI AGCT 4 cut(s) 46, 177, 287, 346
AluI AGCT 4 cut(s) 46, 177, 287, 346
Alw21I GWGCWC 1 cut(s) 179
Alw26I GTCTC 4 cut(s) 345, 373, 545, 624
AlwI GGATC 2 cut(s) 327, 424
ApoI RAATTY 2 cut(s) 302, 443
AspS9I GGNCC 3 cut(s) 184, 547, 589
AsuHPI GGTGA 2 cut(s) 95, 623
AvaII GGWCC 3 cut(s) 184, 547, 589
BanII GRGCYC 1 cut(s) 179
Bbv12I GWGCWC 1 cut(s) 179
BccI CCATC 1 cut(s) 392
BciT130I CCWGG 2 cut(s) 231, 545
BciVI GTATCC 1 cut(s) 692
BcoDI GTCTC 4 cut(s) 345, 373, 545, 624
BfaI CTAG 2 cut(s) 450, 657
BfmI CTRYAG 1 cut(s) 53
BfuI GTATCC 1 cut(s) 692
BisI GCNGC 1 cut(s) 463
BlsI GCNGC 1 cut(s) 464
Bme1390I CCNGG 2 cut(s) 231, 545
Bme18I GGWCC 3 cut(s) 184, 547, 589
BmgT120I GGNCC 3 cut(s) 184, 547, 589
BmiI GGNNCC 2 cut(s) 186, 669
BmrFI CCNGG 2 cut(s) 231, 545
BpmI CTGGAG 1 cut(s) 527
BpuEI CTTGAG 2 cut(s) 141, 631
BsaJI CCNNGG 2 cut(s) 230, 661
Bsc4I CCNNNNNNNGG 1 cut(s) 677
Bse1I ACTGG 1 cut(s) 321
BseBI CCWGG 2 cut(s) 231, 545
BseDI CCNNGG 2 cut(s) 230, 661
BseLI CCNNNNNNNGG 1 cut(s) 677
BseMII CTCAG 3 cut(s) 171, 361, 493
BseNI ACTGG 1 cut(s) 321
BseRI GAGGAG 1 cut(s) 663
BsiHKAI GWGCWC 1 cut(s) 179
BslI CCNNNNNNNGG 1 cut(s) 677
BsmAI GTCTC 4 cut(s) 345, 373, 545, 624
BsmBI CGTCTC 1 cut(s) 624
BsmI GAATGC 1 cut(s) 256
Bsp1286I GDGCHC 1 cut(s) 179
Bsp143I GATC 4 cut(s) 19, 319, 429, 496
Bsp19I CCATGG 1 cut(s) 661
BspACI CCGC 2 cut(s) 463, 522
BspCNI CTCAG 3 cut(s) 172, 360, 492
BspLI GGNNCC 2 cut(s) 186, 669
BspMAI CTGCAG 1 cut(s) 57
BspPI GGATC 2 cut(s) 327, 424
BsrI ACTGG 1 cut(s) 321
BssECI CCNNGG 2 cut(s) 230, 661
BssMI GATC 4 cut(s) 19, 319, 429, 496
BssT1I CCWWGG 1 cut(s) 661
Bst2UI CCWGG 2 cut(s) 231, 545
Bst6I CTCTTC 2 cut(s) 23, 280
BstDEI CTNAG 4 cut(s) 180, 342, 347, 479
BstDSI CCRYGG 1 cut(s) 661
BstKTI GATC 4 cut(s) 22, 322, 432, 499
BstMAI GTCTC 4 cut(s) 345, 373, 545, 624
BstMBI GATC 4 cut(s) 19, 319, 429, 496
BstMWI GCNNNNNNNGC 1 cut(s) 52
BstNI CCWGG 2 cut(s) 231, 545
BstNSI RCATGY 1 cut(s) 167
BstSCI CCNGG 2 cut(s) 229, 543
BstSFI CTRYAG 1 cut(s) 53
BsuI GTATCC 1 cut(s) 692
BtgI CCRYGG 1 cut(s) 661
BtsI GCAGTG 1 cut(s) 50
BtsIMutI CAGTG 2 cut(s) 50, 492
Cfr13I GGNCC 3 cut(s) 184, 547, 589
Csp6I GTAC 1 cut(s) 381
CviAII CATG 5 cut(s) 164, 201, 410, 427, 662
CviQI GTAC 1 cut(s) 381
DdeI CTNAG 4 cut(s) 180, 342, 347, 479
DpnI GATC 4 cut(s) 21, 321, 431, 498
DpnII GATC 4 cut(s) 19, 319, 429, 496
Eam1104I CTCTTC 2 cut(s) 23, 280
EarI CTCTTC 2 cut(s) 23, 280
Ecl136II GAGCTC 1 cut(s) 177
Eco130I CCWWGG 1 cut(s) 661
Eco24I GRGCYC 1 cut(s) 179
Eco47I GGWCC 3 cut(s) 184, 547, 589
Eco53kI GAGCTC 1 cut(s) 177
Eco57I CTGAAG 3 cut(s) 380, 485, 569
EcoICRI GAGCTC 1 cut(s) 177
EcoO109I RGGNCCY 3 cut(s) 184, 547, 589
EcoRII CCWGG 2 cut(s) 229, 543
EcoT14I CCWWGG 1 cut(s) 661
EcoT38I GRGCYC 1 cut(s) 179
ErhI CCWWGG 1 cut(s) 661
Esp3I CGTCTC 1 cut(s) 624
FaeI CATG 5 cut(s) 167, 204, 413, 430, 665
FatI CATG 5 cut(s) 163, 200, 409, 426, 661
FauNDI CATATG 1 cut(s) 401
Fnu4HI GCNGC 1 cut(s) 463
FriOI GRGCYC 1 cut(s) 179
Fsp4HI GCNGC 1 cut(s) 463
FspBI CTAG 2 cut(s) 450, 657
GluI GCNGC 1 cut(s) 463
GsuI CTGGAG 1 cut(s) 527
Hin1II CATG 5 cut(s) 167, 204, 413, 430, 665
HinfI GANTC 3 cut(s) 572, 602, 614
HphI GGTGA 2 cut(s) 95, 623
Hpy188I TCNGA 6 cut(s) 181, 350, 373, 482, 504, 619
Hpy188III TCNNGA 4 cut(s) 23, 358, 587, 685
HpyAV CCTTC 4 cut(s) 74, 479, 560, 593
HpyCH4V TGCA 2 cut(s) 55, 405
HpyF10VI GCNNNNNNNGC 1 cut(s) 52
HpyF3I CTNAG 4 cut(s) 180, 342, 347, 479
Hsp92II CATG 5 cut(s) 167, 204, 413, 430, 665
Kzo9I GATC 4 cut(s) 19, 319, 429, 496
MaeI CTAG 2 cut(s) 450, 657
MaeIII GTNAC 3 cut(s) 3, 166, 652
MalI GATC 4 cut(s) 21, 321, 431, 498
MboI GATC 4 cut(s) 19, 319, 429, 496
MboII GAAGA 3 cut(s) 40, 267, 491
MhlI GDGCHC 1 cut(s) 179
MluCI AATT 3 cut(s) 262, 302, 443
MmeI TCCRAC 3 cut(s) 443, 578, 607
MnlI CCTC 9 cut(s) 18, 165, 175, 382, 443, 465, 476, 681, 684
MseI TTAA 1 cut(s) 126
MspA1I CMGCKG 1 cut(s) 522
MspR9I CCNGG 2 cut(s) 231, 545
Mva1269I GAATGC 1 cut(s) 256
MvaI CCWGG 2 cut(s) 231, 545
MwoI GCNNNNNNNGC 1 cut(s) 52
NcoI CCATGG 1 cut(s) 661
NdeI CATATG 1 cut(s) 401
NdeII GATC 4 cut(s) 19, 319, 429, 496
NlaIII CATG 5 cut(s) 167, 204, 413, 430, 665
NlaIV GGNNCC 2 cut(s) 186, 669
NmuCI GTSAC 2 cut(s) 3, 652
NspI RCATGY 1 cut(s) 167
PciI ACATGT 1 cut(s) 163
PctI GAATGC 1 cut(s) 256
PfeI GAWTC 3 cut(s) 572, 602, 614
PfoI TCCNGGA 1 cut(s) 543
PkrI GCNGC 1 cut(s) 464
PpuMI RGGWCCY 3 cut(s) 184, 547, 589
PscI ACATGT 1 cut(s) 163
Psp124BI GAGCTC 1 cut(s) 179
Psp5II RGGWCCY 3 cut(s) 184, 547, 589
Psp6I CCWGG 2 cut(s) 229, 543
PspGI CCWGG 2 cut(s) 229, 543
PspN4I GGNNCC 2 cut(s) 186, 669
PspPI GGNCC 3 cut(s) 184, 547, 589
PspPPI RGGWCCY 3 cut(s) 184, 547, 589
PstI CTGCAG 1 cut(s) 57
RsaI GTAC 1 cut(s) 382
RsaNI GTAC 1 cut(s) 381
SacI GAGCTC 1 cut(s) 179
SaqAI TTAA 1 cut(s) 126
SatI GCNGC 1 cut(s) 463
Sau3AI GATC 4 cut(s) 19, 319, 429, 496
Sau96I GGNCC 3 cut(s) 184, 547, 589
ScrFI CCNGG 2 cut(s) 231, 545
SduI GDGCHC 1 cut(s) 179
SfcI CTRYAG 1 cut(s) 53
SinI GGWCC 3 cut(s) 184, 547, 589
SmlI CTYRAG 2 cut(s) 156, 646
SmoI CTYRAG 2 cut(s) 156, 646
Sse9I AATT 3 cut(s) 262, 302, 443
SsiI CCGC 2 cut(s) 463, 522
SspI AATATT 1 cut(s) 73
SspMI CTAG 2 cut(s) 450, 657
SstI GAGCTC 1 cut(s) 179
StyD4I CCNGG 2 cut(s) 229, 543
StyI CCWWGG 1 cut(s) 661
TaqI TCGA 1 cut(s) 387
TasI AATT 3 cut(s) 262, 302, 443
TauI GCSGC 1 cut(s) 465
TfiI GAWTC 3 cut(s) 572, 602, 614
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 2 cut(s) 57, 499
TseFI GTSAC 2 cut(s) 3, 652
Tsp45I GTSAC 2 cut(s) 3, 652
TspGWI ACGGA 1 cut(s) 425
TspRI CASTG 2 cut(s) 57, 499
VpaK11BI GGWCC 3 cut(s) 184, 547, 589
XapI RAATTY 2 cut(s) 302, 443
XceI RCATGY 1 cut(s) 167
XspI CTAG 2 cut(s) 450, 657
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.