Rmu_sc0001121.1_g000020

Isoflavone reductase homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001121.1
Physical Location & Seq
Forward (+)
58292 .. 59232
941 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001121.1_g000020.1.cds

Sequence Viewer

Length: 543 bp
atgattgacaatcctttggaaaaggatgaacatgacatggacataggaggtgttccttatatgttactggttgagaaccttgagaaggggatatcaccattcacaattatggaattcatacaccagcaagctacaatctcatgtcaagcatctgtttggccaagtaagtcatcagaggcatatacaagaggaaccatcatagttgacagcaaaagaaatctggaaaagatatctgactttttagagaatccagatcacgttatcatttcctcaaaaggaaggccgtgggtaatgactgagaaatccgcattacatgagacaccaagggcattgatacaaagcttcatgctcatgtctcagacaatattacagaatagaagccctacaacgaacaatggattgaaggttgtcatttctggaactaaagagtatgagacagctaagttgctgaaggatttgtttttggcatttgtaaagcatcaaagtcgacttcacaggaggttacttatagtagagggaaagatctcgcatttgatgctctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

180

Amino Acids

20.47

Weight (kDa)

7.07

Isoelectric Point (pI)

37.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000405)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G25330
fragaria_vesca FvH4_2g12920 FvH4_2g12920 FvH4_2g12920 FvH4_2g12920 FvH4_3g17720 FvH4_3g17720 FvH4_3g20410 FvH4_3g20410 FvH4_5g23730 FvH4_5g23730 FvH4_5g23730 FvH4_6g40510 FvH4_6g40520 FvH4_6g40530 FvH4_6g40530
malus_domestica MD09G1128800.v1.1 MD09G1128900.v1.1 MD09G1129100.v1.1 MD17G1118100.v1.1
prunus_persica Prupe.3G196400_v2.0.a1 Prupe.3G196400_v2.0.a1 Prupe.3G196400_v2.0.a1 Prupe.3G196400_v2.0.a1 Prupe.3G196400_v2.0.a1 Prupe.3G196500_v2.0.a1 Prupe.3G196500_v2.0.a1
pyrus_communis pycom09g05230 pycom09g05240 pycom10g00180 pycom17g10860
rosa_chinensis RchiOBHm_Chr2g0133241 RchiOBHm_Chr2g0133311 RchiOBHm_Chr2g0155531 RchiOBHm_Chr2g0155771 RchiOBHm_Chr2g0155781 RchiOBHm_Chr2g0155791 RchiOBHm_Chr5g0029431 RchiOBHm_Chr5g0034301 RchiOBHm_Chr7g0213061
rosa_laevigata RLG00000002835 RLG00000019323 RLG00000020863 RLG00000020864 RLG00000033165 RLG00000033538
rosa_multiflora Rmu_co8060268.1_g000001 Rmu_sc0000062.1_g000021 Rmu_sc0001121.1_g000020 Rmu_sc0001446.1_g000013 Rmu_sc0002712.1_g000021 Rmu_sc0003417.1_g000005 Rmu_sc0023254.1_g000004 Rmu_sc0024719.1_g000001 Rmu_sc0033434.1_g000002
rosa_roxburghii Rroxscaffold_1G00045970 Rroxscaffold_2G00093480 Rroxscaffold_2G00093490 Rroxscaffold_2G00093500 Rroxscaffold_2G00111280 Rroxscaffold_3G00246280 Rroxscaffold_7G00195910
rosa_rugosa Rorug02G0310900 Rorug02G0449800 Rorug02G0449900 Rorug04G0061300 Rorug05G0145100 Rorug06G0068700 Rorug07G0139100
rosa_samantha Rh2AG363400 Rh2AG515900 Rh2AG516000 Rh2BG369100 Rh2BG525000 Rh2BG526900 Rh2BG527000 Rh2CG346700 Rh2CG500900 Rh2CG501000 Rh2DG386100 Rh2DG535900 Rh2DG536000 Rh5AG236700 Rh5BG204800 Rh5BG237200 Rh5CG226800 Rh5CG267000 Rh5DG208400 Rh5DG244700 Rh7AG270400 Rh7AG270500 Rh7BG266000 Rh7CG289700 Rh7CG289800 Rh7DG278700
rosa_wichuraiana Rw2G029570 Rw2G042430 Rw2G042440 Rw5G021290 Rw7G023500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 487
AciI CCGC 1 cut(s) 306
AcoI YGGCCR 1 cut(s) 158
AcsI RAATTY 1 cut(s) 113
AcuI CTGAAG 1 cut(s) 470
AfiI CCNNNNNNNGG 1 cut(s) 85
AgsI TTSAA 1 cut(s) 403
AluBI AGCT 3 cut(s) 131, 342, 440
AluI AGCT 3 cut(s) 131, 342, 440
Alw26I GTCTC 3 cut(s) 311, 360, 428
AoxI GGCC 2 cut(s) 158, 281
ApoI RAATTY 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 87
BalI TGGCCA 1 cut(s) 160
BccI CCATC 1 cut(s) 203
BceAI ACGGC 1 cut(s) 268
BcgI CGANNNNNNTGC 2 cut(s) 467, 501
BcoDI GTCTC 3 cut(s) 311, 360, 428
BglII AGATCT 1 cut(s) 522
BmiI GGNNCC 1 cut(s) 193
BmsI GCATC 3 cut(s) 158, 487, 525
BpuEI CTTGAG 1 cut(s) 101
BsaJI CCNNGG 2 cut(s) 284, 323
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse1I ACTGG 1 cut(s) 72
BseDI CCNNGG 2 cut(s) 284, 323
BseGI GGATG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 85
BseMII CTCAG 2 cut(s) 288, 371
BseNI ACTGG 1 cut(s) 72
BshFI GGCC 2 cut(s) 160, 283
BslI CCNNNNNNNGG 1 cut(s) 85
BsmAI GTCTC 3 cut(s) 311, 360, 428
BsnI GGCC 2 cut(s) 160, 283
Bsp143I GATC 2 cut(s) 253, 522
BspACI CCGC 1 cut(s) 306
BspANI GGCC 2 cut(s) 160, 283
BspCNI CTCAG 2 cut(s) 289, 370
BspLI GGNNCC 1 cut(s) 193
BsrI ACTGG 1 cut(s) 72
BssECI CCNNGG 2 cut(s) 284, 323
BssMI GATC 2 cut(s) 253, 522
BssT1I CCWWGG 1 cut(s) 323
BstAPI GCANNNNNTGC 1 cut(s) 535
BstC8I GCNNGC 1 cut(s) 129
BstDEI CTNAG 3 cut(s) 297, 357, 441
BstDSI CCRYGG 1 cut(s) 284
BstENI CCTNNNNNAGG 1 cut(s) 83
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 2 cut(s) 256, 525
BstMAI GTCTC 3 cut(s) 311, 360, 428
BstMBI GATC 2 cut(s) 253, 522
BstMWI GCNNNNNNNGC 1 cut(s) 535
BstX2I RGATCY 1 cut(s) 522
BstYI RGATCY 1 cut(s) 522
BsuRI GGCC 2 cut(s) 160, 283
BtgI CCRYGG 1 cut(s) 284
BtsCI GGATG 1 cut(s) 31
Cac8I GCNNGC 1 cut(s) 129
CviAII CATG 6 cut(s) 32, 37, 141, 314, 346, 352
CviJI RGCY 6 cut(s) 131, 160, 283, 342, 381, 440
CviKI_1 RGCY 6 cut(s) 131, 160, 283, 342, 381, 440
DdeI CTNAG 3 cut(s) 297, 357, 441
DpnI GATC 2 cut(s) 255, 524
DpnII GATC 2 cut(s) 253, 522
EaeI YGGCCR 1 cut(s) 158
Eco130I CCWWGG 1 cut(s) 323
Eco32I GATATC 2 cut(s) 93, 231
Eco57I CTGAAG 1 cut(s) 470
EcoNI CCTNNNNNAGG 1 cut(s) 83
EcoRI GAATTC 1 cut(s) 113
EcoRV GATATC 2 cut(s) 93, 231
EcoT14I CCWWGG 1 cut(s) 323
ErhI CCWWGG 1 cut(s) 323
FaeI CATG 6 cut(s) 35, 40, 144, 317, 349, 355
FatI CATG 6 cut(s) 31, 36, 140, 313, 345, 351
FblI GTMKAC 1 cut(s) 487
FokI GGATG 1 cut(s) 38
HaeIII GGCC 2 cut(s) 160, 283
Hin1II CATG 6 cut(s) 35, 40, 144, 317, 349, 355
HincII GTYRAC 2 cut(s) 205, 488
HindII GTYRAC 2 cut(s) 205, 488
HindIII AAGCTT 1 cut(s) 340
HinfI GANTC 1 cut(s) 247
HphI GGTGA 1 cut(s) 87
Hpy166II GTNNAC 2 cut(s) 205, 488
Hpy188I TCNGA 4 cut(s) 175, 235, 360, 542
Hpy188III TCNNGA 3 cut(s) 221, 251, 417
Hpy8I GTNNAC 2 cut(s) 205, 488
HpyAV CCTTC 4 cut(s) 79, 273, 397, 445
HpyCH4IV ACGT 1 cut(s) 258
HpyF10VI GCNNNNNNNGC 1 cut(s) 535
HpyF3I CTNAG 3 cut(s) 297, 357, 441
HpySE526I ACGT 1 cut(s) 258
Hsp92II CATG 6 cut(s) 35, 40, 144, 317, 349, 355
Kzo9I GATC 2 cut(s) 253, 522
LpnPI CCDG 6 cut(s) 53, 137, 206, 264, 402, 481
LweI GCATC 3 cut(s) 158, 487, 525
MaeII ACGT 1 cut(s) 258
MaeIII GTNAC 2 cut(s) 63, 501
MalI GATC 2 cut(s) 255, 524
MboI GATC 2 cut(s) 253, 522
MflI RGATCY 1 cut(s) 522
MlsI TGGCCA 1 cut(s) 160
MluCI AATT 2 cut(s) 105, 113
MluNI TGGCCA 1 cut(s) 160
MnlI CCTC 6 cut(s) 41, 169, 182, 280, 492, 508
Mox20I TGGCCA 1 cut(s) 160
MscI TGGCCA 1 cut(s) 160
MslI CAYNNNNRTG 2 cut(s) 107, 350
Msp20I TGGCCA 1 cut(s) 160
MwoI GCNNNNNNNGC 1 cut(s) 535
NdeII GATC 2 cut(s) 253, 522
NlaIII CATG 6 cut(s) 35, 40, 144, 317, 349, 355
NlaIV GGNNCC 1 cut(s) 193
PfeI GAWTC 1 cut(s) 247
PspN4I GGNNCC 1 cut(s) 193
PsuI RGATCY 1 cut(s) 522
RseI CAYNNNNRTG 2 cut(s) 107, 350
SalI GTCGAC 1 cut(s) 486
Sau3AI GATC 2 cut(s) 253, 522
SetI ASST 8 cut(s) 52, 81, 133, 261, 344, 408, 442, 503
SfaNI GCATC 3 cut(s) 158, 487, 525
SmiMI CAYNNNNRTG 2 cut(s) 107, 350
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
Sse9I AATT 2 cut(s) 105, 113
SsiI CCGC 1 cut(s) 306
SspI AATATT 1 cut(s) 366
StyI CCWWGG 1 cut(s) 323
TaiI ACGT 1 cut(s) 261
TaqI TCGA 1 cut(s) 487
TasI AATT 2 cut(s) 105, 113
TfiI GAWTC 1 cut(s) 247
TspDTI ATGAA 3 cut(s) 42, 106, 334
XagI CCTNNNNNAGG 1 cut(s) 83
XapI RAATTY 1 cut(s) 113
XmiI GTMKAC 1 cut(s) 487
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.