Rmu_sc0010412.1_g000002

(R)-mandelonitrile lyase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010412.1
Physical Location & Seq
Reverse (-)
7920 .. 11935
4016 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010412.1_g000002.1.cds

Sequence Viewer

Length: 1395 bp
ctgcgaatagacttgagtagcaaagatggaatcttccttgcgcaatgttgcgaactccgatgcggtcttgcgccgggtcgctatacaatccatgatatattgatattgtttcctccactgggtaagctctcgatcgcgttgttcagcttctcgagcgcgctactccctttgcttttggtcgaagtcgcgaagacgctgttccgtcctcatgatcaacgtagccagctgcctccgatatttgtcattgttgaccgtaaggatgcagagtcgttcgttgatgctagcaccctttgggatggggagagacacgaactcatcatcaatttctgtattgccagtagtggcaacattggccatcttgtcactttagaaatcgatggtgggttggtgatcagcgttagagccggcggtggtggtgggctggcaatcagcgatctcgccggcggctatgtagaaggacccagatccggatctgggatcctggaggtttttgcaaacgggtctggatctggtatttcggctcgaggggtgatatatactgattccaatgggaggtctcacggggcatttgtacgtggtgagggagaggttattctgagtgcaggggcaattgggagtcctcagcttctacttcttagcggtgttggtcctcagtcctatctatcatctttgaaaatcctagttgttcacccccaacctcacagtggaaactttatgtatgacaatcctcttaattttattaccattttatccccgtttccactacaggcctcaactgtaaagattgtcggcattaccgaccatttctacgtagagaccttctctagcatgcccatttctactacaccctatagtctttttccagatccggctaaacttaaaaggataaattcaagtttaggactcatttacatcaaattggtaggaccttcgtcttatggtactctgaagcttcaatcatcatctgatgtgagagttggtccaaatgtccgcctcaactactttgcacatcccttggaccttgctcgctgtgtttctggcatgaagaagattggggagttattaaataccaagtcactgaaagcatttaagtttctagcttcgtcgagcacaaaagcttacaagttttatggtccaactttacctatgaaccaaacagatgatgcatcttttggagaattttgtcgtcatacagtatcaacactttggcatttccatggaggatgcctggtcggaaaggtggtcgatagcagcttgcaggtcatgggaatcgatgctttgcgtgttgttgacgcatccacattcaatttcacaccggggacaaatccacaggccacacttatgatgttgggcaggtacattggcattaagatgctgcaacaaagatcttcttaa

Protein Analysis

464

Amino Acids

49.83

Weight (kDa)

8.73

Isoelectric Point (pI)

34.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000533)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g08950 FvH4_6g09340
malus_domestica MD00G1012800.v1.1 MD00G1012900.v1.1 MD00G1013000.v1.1 MD00G1013300.v1.1 MD03G1090900.v1.1 MD03G1091100.v1.1 MD03G1091300.v1.1 MD03G1091400.v1.1 MD03G1091700.v1.1 MD03G1091900.v1.1 MD10G1279300.v1.1 MD13G1264000.v1.1 MD13G1264100.v1.1 MD13G1264200.v1.1 MD13G1264500.v1.1 MD16G1093000.v1.1 MD16G1093100.v1.1 MD16G1265300.v1.1 MD16G1265500.v1.1
prunus_persica Prupe.1G007400_v2.0.a1 Prupe.1G092200_v2.0.a1 Prupe.1G092300_v2.0.a1 Prupe.1G092400_v2.0.a1 Prupe.1G092500_v2.0.a1 Prupe.1G092700_v2.0.a1 Prupe.1G092900_v2.0.a1 Prupe.1G093000_v2.0.a1 Prupe.1G093200_v2.0.a1 Prupe.1G093300_v2.0.a1 Prupe.1G093500_v2.0.a1 Prupe.1G093600_v2.0.a1 Prupe.1G093600_v2.0.a1 Prupe.1G093600_v2.0.a1 Prupe.1G093700_v2.0.a1 Prupe.1G093800_v2.0.a1 Prupe.1G093800_v2.0.a1 Prupe.1G096400_v2.0.a1 Prupe.1G096500_v2.0.a1 Prupe.1G096500_v2.0.a1
pyrus_communis pycom03g07290 pycom03g07320 pycom10g23300 pycom11g08780 pycom11g08790 pycom11g08810 pycom11g08820 pycom13g23800
rosa_chinensis RchiOBHm_Chr4g0403711 RchiOBHm_Chr4g0403741 RchiOBHm_Chr4g0403781
rosa_laevigata RLG00000008950 RLG00000008955 RLG00000008957 RLG00000008959
rosa_multiflora Rmu_co8470309.1_g000001 Rmu_sc0001496.1_g000015 Rmu_sc0004115.1_g000016 Rmu_sc0004388.1_g000007 Rmu_sc0007461.1_g000001 Rmu_sc0010412.1_g000002
rosa_roxburghii Rroxscaffold_5G00348330 Rroxscaffold_5G00348340 Rroxscaffold_5G00348350 Rroxscaffold_5G00348400
rosa_rugosa Rorug04G0045400 Rorug04G0045500 Rorug04G0045600
rosa_samantha Rh4AG120800 Rh4AG121000 Rh4BG113600 Rh4BG113900 Rh4BG114000 Rh4CG128300 Rh4CG129200 Rh4CG129300 Rh4CG129400 Rh4DG113700 Rh4DG113800 Rh4DG113900
rosa_wichuraiana Rw0G001200 Rw4G009830 Rw4G009850 Rw4G009860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 42
Acc36I ACCTGC 2 cut(s) 1249, 1344
AccII CGCG 3 cut(s) 137, 158, 188
AccIII TCCGGA 1 cut(s) 467
AciI CCGC 5 cut(s) 63, 408, 444, 639, 991
AclWI GGATC 6 cut(s) 459, 472, 478, 485, 514, 860
AcoI YGGCCR 1 cut(s) 352
AcsI RAATTY 2 cut(s) 889, 1178
AcuI CTGAAG 1 cut(s) 968
AfaI GTAC 3 cut(s) 573, 943, 1358
AfiI CCNNNNNNNGG 5 cut(s) 119, 467, 474, 552, 704
AgsI TTSAA 4 cut(s) 673, 894, 956, 1306
AjnI CCWGG 2 cut(s) 480, 1227
AluBI AGCT 8 cut(s) 127, 147, 226, 625, 952, 1100, 1118, 1254
AluI AGCT 8 cut(s) 127, 147, 226, 625, 952, 1100, 1118, 1254
Alw21I GWGCWC 1 cut(s) 1112
Alw26I GTCTC 3 cut(s) 298, 561, 809
AlwI GGATC 6 cut(s) 459, 472, 478, 485, 514, 860
Ama87I CYCGRG 2 cut(s) 151, 522
Aor13HI TCCGGA 1 cut(s) 467
AoxI GGCC 3 cut(s) 352, 768, 1332
ApeKI GCWGC 3 cut(s) 226, 1251, 1375
ApoI RAATTY 2 cut(s) 889, 1178
AspLEI GCGC 4 cut(s) 43, 73, 158, 160
AspS9I GGNCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
AsuC2I CCSGG 2 cut(s) 75, 1317
AsuHPI GGTGA 4 cut(s) 400, 541, 590, 680
AsuNHI GCTAGC 1 cut(s) 281
AvaI CYCGRG 2 cut(s) 151, 522
AvaII GGWCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
BalI TGGCCA 1 cut(s) 354
BamHI GGATCC 1 cut(s) 477
BbsI GAAGAC 1 cut(s) 197
Bbv12I GWGCWC 1 cut(s) 1112
BbvCI CCTCAGC 1 cut(s) 621
BbvI GCAGC 3 cut(s) 213, 1263, 1362
BccI CCATC 4 cut(s) 20, 290, 363, 371
BciT130I CCWGG 2 cut(s) 482, 1229
BclI TGATCA 2 cut(s) 211, 390
BcnI CCSGG 2 cut(s) 75, 1317
BcoDI GTCTC 3 cut(s) 298, 561, 809
BfaI CTAG 4 cut(s) 282, 680, 825, 1097
BfmI CTRYAG 2 cut(s) 764, 850
BfuAI ACCTGC 2 cut(s) 1249, 1344
BglII AGATCT 1 cut(s) 1385
BisI GCNGC 4 cut(s) 227, 445, 1252, 1376
BlsI GCNGC 4 cut(s) 228, 446, 1253, 1377
Bme1390I CCNGG 4 cut(s) 75, 482, 1229, 1317
Bme18I GGWCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
BmeT110I CYCGRG 2 cut(s) 151, 522
BmgT120I GGNCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
BmiI GGNNCC 2 cut(s) 460, 479
BmrFI CCNGG 4 cut(s) 75, 482, 1229, 1317
BmrI ACTGGG 1 cut(s) 128
BmsI GCATC 9 cut(s) 50, 250, 268, 1153, 1175, 1214, 1264, 1304, 1362
BmtI GCTAGC 1 cut(s) 285
BmuI ACTGGG 1 cut(s) 128
BoxI GACNNNNGTC 1 cut(s) 931
BpiI GAAGAC 1 cut(s) 197
BplI GAGNNNNNCTC 2 cut(s) 806, 838
BpmI CTGGAG 1 cut(s) 503
Bpu10I CCTNAGC 1 cut(s) 621
BpuEI CTTGAG 1 cut(s) 34
BpuMI CCSGG 2 cut(s) 75, 1317
Bsa29I ATCGAT 2 cut(s) 375, 1272
BsaAI YACGTR 2 cut(s) 575, 811
BsaBI GATNNNNATC 1 cut(s) 469
BsaI GGTCTC 2 cut(s) 561, 809
BsaJI CCNNGG 3 cut(s) 1014, 1216, 1316
BsaWI WCCGGW 1 cut(s) 467
Bsc4I CCNNNNNNNGG 5 cut(s) 119, 467, 474, 552, 704
Bse118I RCCGGY 2 cut(s) 404, 440
Bse1I ACTGG 2 cut(s) 123, 336
Bse3DI GCAATG 1 cut(s) 50
Bse8I GATNNNNATC 1 cut(s) 469
BseAI TCCGGA 1 cut(s) 467
BseBI CCWGG 2 cut(s) 482, 1229
BseCI ATCGAT 2 cut(s) 375, 1272
BseDI CCNNGG 3 cut(s) 1014, 1216, 1316
BseGI GGATG 5 cut(s) 265, 301, 1009, 1229, 1295
BseJI GATNNNNATC 1 cut(s) 469
BseLI CCNNNNNNNGG 5 cut(s) 119, 467, 474, 552, 704
BseMI GCAATG 1 cut(s) 50
BseMII CTCAG 3 cut(s) 587, 635, 665
BseNI ACTGG 2 cut(s) 123, 336
BsePI GCGCGC 1 cut(s) 156
BseXI GCAGC 3 cut(s) 213, 1263, 1362
BsgI GTGCAG 1 cut(s) 621
Bsh1236I CGCG 3 cut(s) 137, 158, 188
Bsh1285I CGRYCG 1 cut(s) 135
BshFI GGCC 3 cut(s) 354, 770, 1334
BshVI ATCGAT 2 cut(s) 375, 1272
BsiEI CGRYCG 1 cut(s) 135
BsiHKAI GWGCWC 1 cut(s) 1112
BsiHKCI CYCGRG 2 cut(s) 151, 522
BsiSI CCGG 6 cut(s) 74, 405, 441, 468, 869, 1316
BslFI GGGAC 1 cut(s) 1333
BslI CCNNNNNNNGG 5 cut(s) 119, 467, 474, 552, 704
BsmAI GTCTC 3 cut(s) 298, 561, 809
BsmFI GGGAC 1 cut(s) 1333
BsnI GGCC 3 cut(s) 354, 770, 1334
Bso31I GGTCTC 2 cut(s) 561, 809
BsoBI CYCGRG 2 cut(s) 151, 522
Bsp1286I GDGCHC 1 cut(s) 1112
Bsp13I TCCGGA 1 cut(s) 467
Bsp19I CCATGG 1 cut(s) 1216
Bsp68I TCGCGA 1 cut(s) 188
BspACI CCGC 5 cut(s) 63, 408, 444, 639, 991
BspANI GGCC 3 cut(s) 354, 770, 1334
BspCNI CTCAG 3 cut(s) 588, 634, 664
BspDI ATCGAT 2 cut(s) 375, 1272
BspEI TCCGGA 1 cut(s) 467
BspFNI CGCG 3 cut(s) 137, 158, 188
BspHI TCATGA 1 cut(s) 208
BspLI GGNNCC 2 cut(s) 460, 479
BspMI ACCTGC 2 cut(s) 1249, 1344
BspOI GCTAGC 1 cut(s) 285
BspPI GGATC 6 cut(s) 459, 472, 478, 485, 514, 860
BspTNI GGTCTC 2 cut(s) 561, 809
BsrDI GCAATG 1 cut(s) 50
BsrFI RCCGGY 2 cut(s) 404, 440
BsrI ACTGG 2 cut(s) 123, 336
BssAI RCCGGY 2 cut(s) 404, 440
BssECI CCNNGG 3 cut(s) 1014, 1216, 1316
BssHII GCGCGC 1 cut(s) 156
BssT1I CCWWGG 2 cut(s) 1014, 1216
Bst2UI CCWGG 2 cut(s) 482, 1229
Bst4CI ACNGT 4 cut(s) 254, 704, 778, 1195
BstBAI YACGTR 2 cut(s) 575, 811
BstC8I GCNNGC 9 cut(s) 158, 224, 283, 406, 423, 442, 830, 1027, 1256
BstDEI CTNAG 4 cut(s) 596, 621, 635, 651
BstDSI CCRYGG 1 cut(s) 1216
BstF5I GGATG 5 cut(s) 265, 301, 1009, 1229, 1295
BstFNI CGCG 3 cut(s) 137, 158, 188
BstHHI GCGC 4 cut(s) 43, 73, 158, 160
BstMAI GTCTC 3 cut(s) 298, 561, 809
BstMCI CGRYCG 1 cut(s) 135
BstMWI GCNNNNNNNGC 2 cut(s) 153, 351
BstNI CCWGG 2 cut(s) 482, 1229
BstNSI RCATGY 1 cut(s) 832
BstPAI GACNNNNGTC 1 cut(s) 931
BstSCI CCNGG 4 cut(s) 73, 480, 1227, 1315
BstSFI CTRYAG 2 cut(s) 764, 850
BstSNI TACGTA 1 cut(s) 811
BstUI CGCG 3 cut(s) 137, 158, 188
BstV1I GCAGC 3 cut(s) 213, 1263, 1362
BstV2I GAAGAC 1 cut(s) 197
BstX2I RGATCY 6 cut(s) 464, 470, 477, 506, 865, 1385
BstYI RGATCY 6 cut(s) 464, 470, 477, 506, 865, 1385
Bsu15I ATCGAT 2 cut(s) 375, 1272
BsuRI GGCC 3 cut(s) 354, 770, 1334
BsuTUI ATCGAT 2 cut(s) 375, 1272
BtgI CCRYGG 1 cut(s) 1216
BtsCI GGATG 5 cut(s) 265, 301, 1009, 1229, 1295
BtsIMutI CAGTG 3 cut(s) 116, 709, 1076
BtuMI TCGCGA 1 cut(s) 188
BveI ACCTGC 2 cut(s) 1249, 1344
Cac8I GCNNGC 9 cut(s) 158, 224, 283, 406, 423, 442, 830, 1027, 1256
CciI TCATGA 1 cut(s) 208
CfoI GCGC 4 cut(s) 43, 73, 158, 160
Cfr10I RCCGGY 2 cut(s) 404, 440
Cfr13I GGNCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
ClaI ATCGAT 2 cut(s) 375, 1272
CseI GACGC 2 cut(s) 202, 1301
Csp6I GTAC 3 cut(s) 572, 942, 1357
CviAII CATG 6 cut(s) 92, 209, 829, 1042, 1217, 1264
CviQI GTAC 3 cut(s) 572, 942, 1357
DdeI CTNAG 4 cut(s) 596, 621, 635, 651
EaeI YGGCCR 1 cut(s) 352
EciI GGCGGA 1 cut(s) 980
Eco105I TACGTA 1 cut(s) 811
Eco130I CCWWGG 2 cut(s) 1014, 1216
Eco147I AGGCCT 1 cut(s) 770
Eco31I GGTCTC 2 cut(s) 561, 809
Eco47I GGWCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
Eco57I CTGAAG 1 cut(s) 968
Eco88I CYCGRG 2 cut(s) 151, 522
EcoO109I RGGNCCY 2 cut(s) 458, 926
EcoRII CCWGG 2 cut(s) 480, 1227
EcoT14I CCWWGG 2 cut(s) 1014, 1216
EcoT22I ATGCAT 1 cut(s) 1168
ErhI CCWWGG 2 cut(s) 1014, 1216
FaeI CATG 6 cut(s) 95, 212, 832, 1045, 1220, 1267
FalI AAGNNNNNCTT 1 cut(s) 1375
FaqI GGGAC 1 cut(s) 1333
FatI CATG 6 cut(s) 91, 208, 828, 1041, 1216, 1263
FbaI TGATCA 2 cut(s) 211, 390
Fnu4HI GCNGC 4 cut(s) 227, 445, 1252, 1376
FokI GGATG 5 cut(s) 272, 308, 996, 1236, 1282
Fsp4HI GCNGC 4 cut(s) 227, 445, 1252, 1376
FspBI CTAG 4 cut(s) 282, 680, 825, 1097
FspI TGCGCA 1 cut(s) 42
GlaI GCGC 4 cut(s) 42, 72, 157, 159
GluI GCNGC 4 cut(s) 227, 445, 1252, 1376
GsuI CTGGAG 1 cut(s) 503
HaeIII GGCC 3 cut(s) 354, 770, 1334
HapII CCGG 6 cut(s) 74, 405, 441, 468, 869, 1316
HgaI GACGC 2 cut(s) 202, 1301
HhaI GCGC 4 cut(s) 43, 73, 158, 160
Hin1II CATG 6 cut(s) 95, 212, 832, 1045, 1220, 1267
Hin6I GCGC 4 cut(s) 41, 71, 156, 158
HinP1I GCGC 4 cut(s) 41, 71, 156, 158
HincII GTYRAC 2 cut(s) 250, 1291
HindII GTYRAC 2 cut(s) 250, 1291
HindIII AAGCTT 2 cut(s) 950, 1116
HinfI GANTC 6 cut(s) 30, 266, 542, 616, 903, 1269
HpaII CCGG 6 cut(s) 74, 405, 441, 468, 869, 1316
HphI GGTGA 4 cut(s) 400, 541, 590, 680
Hpy166II GTNNAC 3 cut(s) 250, 688, 1291
Hpy188I TCNGA 6 cut(s) 59, 234, 597, 948, 967, 1235
Hpy188III TCNNGA 7 cut(s) 130, 151, 187, 209, 468, 504, 863
Hpy8I GTNNAC 3 cut(s) 250, 688, 1291
Hpy99I CGWCG 1 cut(s) 1108
HpyAV CCTTC 3 cut(s) 449, 829, 939
HpyCH4III ACNGT 4 cut(s) 254, 704, 778, 1195
HpyCH4IV ACGT 3 cut(s) 217, 574, 810
HpyCH4V TGCA 7 cut(s) 263, 494, 602, 1007, 1166, 1258, 1378
HpyF10VI GCNNNNNNNGC 2 cut(s) 153, 351
HpyF3I CTNAG 4 cut(s) 596, 621, 635, 651
HpySE526I ACGT 3 cut(s) 217, 574, 810
Hsp92II CATG 6 cut(s) 95, 212, 832, 1045, 1220, 1267
HspAI GCGC 4 cut(s) 41, 71, 156, 158
Kpn2I TCCGGA 1 cut(s) 467
KroI GCCGGC 2 cut(s) 404, 440
KroNI GCCGGC 2 cut(s) 406, 442
Ksp22I TGATCA 2 cut(s) 211, 390
Lsp1109I GCAGC 3 cut(s) 213, 1263, 1362
LweI GCATC 9 cut(s) 50, 250, 268, 1153, 1175, 1214, 1264, 1304, 1362
MaeI CTAG 4 cut(s) 282, 680, 825, 1097
MaeII ACGT 3 cut(s) 217, 574, 810
MaeIII GTNAC 2 cut(s) 361, 1074
MboII GAAGA 5 cut(s) 25, 202, 1057, 1060, 1380
MfeI CAATTG 1 cut(s) 609
MflI RGATCY 6 cut(s) 464, 470, 477, 506, 865, 1385
MhlI GDGCHC 1 cut(s) 1112
MlsI TGGCCA 1 cut(s) 354
MluCI AATT 7 cut(s) 322, 609, 733, 889, 917, 1178, 1306
MluNI TGGCCA 1 cut(s) 354
MlyI GAGTC 3 cut(s) 275, 625, 897
MmeI TCCRAC 2 cut(s) 1160, 1213
Mox20I TGGCCA 1 cut(s) 354
Mph1103I ATGCAT 1 cut(s) 1168
MreI CGCCGGCG 1 cut(s) 440
MroI TCCGGA 1 cut(s) 467
MroNI GCCGGC 2 cut(s) 404, 440
MscI TGGCCA 1 cut(s) 354
MseI TTAA 6 cut(s) 732, 879, 1064, 1089, 1368, 1393
MslI CAYNNNNRTG 3 cut(s) 1215, 1340, 1370
Msp20I TGGCCA 1 cut(s) 354
MspA1I CMGCKG 1 cut(s) 226
MspI CCGG 6 cut(s) 74, 405, 441, 468, 869, 1316
MspR9I CCNGG 4 cut(s) 75, 482, 1229, 1317
MunI CAATTG 1 cut(s) 609
MvaI CCWGG 2 cut(s) 482, 1229
MvnI CGCG 3 cut(s) 137, 158, 188
MwoI GCNNNNNNNGC 2 cut(s) 153, 351
NaeI GCCGGC 2 cut(s) 406, 442
NciI CCSGG 2 cut(s) 75, 1317
NcoI CCATGG 1 cut(s) 1216
NgoMIV GCCGGC 2 cut(s) 404, 440
NheI GCTAGC 1 cut(s) 281
NlaIII CATG 6 cut(s) 95, 212, 832, 1045, 1220, 1267
NlaIV GGNNCC 2 cut(s) 460, 479
NmuCI GTSAC 2 cut(s) 361, 1074
NruI TCGCGA 1 cut(s) 188
NsbI TGCGCA 1 cut(s) 42
NsiI ATGCAT 1 cut(s) 1168
NspI RCATGY 1 cut(s) 832
PaeI GCATGC 1 cut(s) 832
PaeR7I CTCGAG 2 cut(s) 151, 522
PagI TCATGA 1 cut(s) 208
PauI GCGCGC 1 cut(s) 156
PceI AGGCCT 1 cut(s) 770
PcsI WCGNNNNNNNCGW 1 cut(s) 795
PdiI GCCGGC 2 cut(s) 406, 442
PfeI GAWTC 3 cut(s) 30, 542, 1269
PfoI TCCNGGA 1 cut(s) 480
PkrI GCNGC 4 cut(s) 228, 446, 1253, 1377
Ple19I CGATCG 1 cut(s) 135
PleI GAGTC 3 cut(s) 274, 624, 897
PpsI GAGTC 3 cut(s) 274, 624, 897
Ppu21I YACGTR 2 cut(s) 575, 811
PpuMI RGGWCCY 2 cut(s) 458, 926
PshAI GACNNNNGTC 1 cut(s) 931
Psp5II RGGWCCY 2 cut(s) 458, 926
Psp6I CCWGG 2 cut(s) 480, 1227
PspGI CCWGG 2 cut(s) 480, 1227
PspN4I GGNNCC 2 cut(s) 460, 479
PspPI GGNCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
PspPPI RGGWCCY 2 cut(s) 458, 926
PspXI VCTCGAGB 1 cut(s) 522
PsuI RGATCY 6 cut(s) 464, 470, 477, 506, 865, 1385
PteI GCGCGC 1 cut(s) 156
PvuI CGATCG 1 cut(s) 135
PvuII CAGCTG 1 cut(s) 226
RruI TCGCGA 1 cut(s) 188
RsaI GTAC 3 cut(s) 573, 943, 1358
RsaNI GTAC 3 cut(s) 572, 942, 1357
RseI CAYNNNNRTG 3 cut(s) 1215, 1340, 1370
SaqAI TTAA 6 cut(s) 732, 879, 1064, 1089, 1368, 1393
SatI GCNGC 4 cut(s) 227, 445, 1252, 1376
Sau96I GGNCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
SchI GAGTC 3 cut(s) 275, 625, 897
ScrFI CCNGG 4 cut(s) 75, 482, 1229, 1317
SduI GDGCHC 1 cut(s) 1112
SfaNI GCATC 9 cut(s) 50, 250, 268, 1153, 1175, 1214, 1264, 1304, 1362
SfcI CTRYAG 2 cut(s) 764, 850
Sfr274I CTCGAG 2 cut(s) 151, 522
SgrAI CRCCGGYG 1 cut(s) 440
SinI GGWCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
SlaI CTCGAG 2 cut(s) 151, 522
SmiMI CAYNNNNRTG 3 cut(s) 1215, 1340, 1370
SmlI CTYRAG 3 cut(s) 13, 151, 522
SmoI CTYRAG 3 cut(s) 13, 151, 522
SnaBI TACGTA 1 cut(s) 811
SphI GCATGC 1 cut(s) 832
Sse9I AATT 7 cut(s) 322, 609, 733, 889, 917, 1178, 1306
SseBI AGGCCT 1 cut(s) 770
SsiI CCGC 5 cut(s) 63, 408, 444, 639, 991
SspMI CTAG 4 cut(s) 282, 680, 825, 1097
StuI AGGCCT 1 cut(s) 770
StyD4I CCNGG 4 cut(s) 73, 480, 1227, 1315
StyI CCWWGG 2 cut(s) 1014, 1216
TaaI ACNGT 4 cut(s) 254, 704, 778, 1195
TaiI ACGT 3 cut(s) 220, 577, 813
TaqI TCGA 8 cut(s) 131, 152, 180, 375, 523, 1106, 1245, 1272
TasI AATT 7 cut(s) 322, 609, 733, 889, 917, 1178, 1306
TauI GCSGC 1 cut(s) 447
TfiI GAWTC 3 cut(s) 30, 542, 1269
Tru1I TTAA 6 cut(s) 732, 879, 1064, 1089, 1368, 1393
Tru9I TTAA 6 cut(s) 732, 879, 1064, 1089, 1368, 1393
TscAI CASTG 3 cut(s) 123, 709, 1083
TseFI GTSAC 2 cut(s) 361, 1074
TseI GCWGC 3 cut(s) 226, 1251, 1375
Tsp45I GTSAC 2 cut(s) 361, 1074
TspDTI ATGAA 2 cut(s) 1058, 1163
TspGWI ACGGA 1 cut(s) 191
TspRI CASTG 3 cut(s) 123, 709, 1083
VpaK11BI GGWCC 6 cut(s) 458, 647, 926, 980, 1018, 1133
XapI RAATTY 2 cut(s) 889, 1178
XceI RCATGY 1 cut(s) 832
XcmI CCANNNNNNNNNTGG 1 cut(s) 701
XhoI CTCGAG 2 cut(s) 151, 522
XspI CTAG 4 cut(s) 282, 680, 825, 1097
Zsp2I ATGCAT 1 cut(s) 1168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.