Rmu_sc0010912.1_g000001

Belongs to the cytochrome P450 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010912.1
OG0000218
Physical Location & Seq
Reverse (-)
9809 .. 10762
954 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010912.1_g000001.1.cds

Sequence Viewer

Length: 954 bp
atggacgacctcttcttctgcacatctctgcccctcatcttcatcctcttgatcaccatcaaatccctttttcgatcaaaacaacacagtcgcacaaacctcccaccaagccctccatctttaccaattataggccatctccatctcctaaaaccgttggcccatcggaccttccaccatctctcacaaaaatatggccctgttttctccctctggttcggctcacatcgtgtggttgtagtctcttcatcgtcaattgctgaagaatgtttcaccaaaaacgatgtagttctggcaaaccgtcctcgcttcatgcttgcaggcaaacacatgggctacaactacaccactgtggtggagtccccatatggggatcactggcgcaacctacgccgtattggcgctaccgatatctactctcccactaggctcaacatgttctcgagcatcaggaaggacgaagtcaagcaattgctgttcagactctcacacaactcacgtgaagattttgcaaaggtggacttgagatccatgttctctgagctgacatttaacatcataatgacaatggtggcagggaagaggtattatggagatggcatgtcagacaaagaaaaggccaaacagttcagagatctcatgagcgagggtttgtcatatggtggcgcaacaaatccctcagattttgtgcctatattgaaatggtttggaggtggtggggctgagaagaaggtgatggacttggctaagaggatggatgcattcttgcaaggtttgatcgatgagcagaatctgagtaaaactacttcagatcggagtacagcaaatactttgatccgccatttactttctcttcaagaatcacagcctgagtattacactgaccaaattatcaaagggcttatactggttagtacaatcattcaatctctgcatcaagctacatggatataa

Protein Analysis

317

Amino Acids

36.11

Weight (kDa)

9.46

Isoelectric Point (pI)

51.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000218)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G66540 AT1G66540 AT4G37340 AT4G37360 AT4G37370 AT5G36220 AT5G36220
fragaria_vesca FvH4_1g16862 FvH4_1g16870 FvH4_1g16871 FvH4_1g16920 FvH4_1g16921 FvH4_1g16930 FvH4_1g23681 FvH4_1g23710
malus_domestica MD03G1281500.v1.1 MD08G1089700.v1.1 MD15G1074700.v1.1 MD15G1289800.v1.1 MD15G1290300.v1.1
prunus_persica Prupe.6G226600_v2.0.a1 Prupe.6G226800_v2.0.a1 Prupe.6G226900_v2.0.a1 Prupe.6G227000_v2.0.a1 Prupe.6G227100_v2.0.a1 Prupe.6G227300_v2.0.a1 Prupe.6G227400_v2.0.a1
pyrus_communis pycom15g25350 pycom15g25360 pycom15g25370 pycom15g25400
rosa_chinensis RchiOBHm_Chr2g0106831 RchiOBHm_Chr2g0106851 RchiOBHm_Chr2g0106901 RchiOBHm_Chr2g0106911 RchiOBHm_Chr2g0106971 RchiOBHm_Chr2g0106991 RchiOBHm_Chr2g0119331 RchiOBHm_Chr2g0119351 RchiOBHm_Chr2g0119391 RchiOBHm_Chr2g0119411 RchiOBHm_Chr2g0119481 RchiOBHm_Chr2g0119541 RchiOBHm_Chr5g0076421
rosa_laevigata RLG00000012204 RLG00000017542 RLG00000017543 RLG00000017547 RLG00000017549 RLG00000018145 RLG00000018146 RLG00000018148 RLG00000018462 RLG00000018464 RLG00000018465 RLG00000018468 RLG00000018470 RLG00000018471 RLG00000018539 RLG00000018540 RLG00000018592
rosa_multiflora Rmu_co8030410.1_g000001 Rmu_co8333451.1_g000001 Rmu_co8389363.1_g000001 Rmu_sc0001801.1_g000006 Rmu_sc0001801.1_g000023 Rmu_sc0001801.1_g000036 Rmu_sc0002788.1_g000013 Rmu_sc0002868.1_g000014 Rmu_sc0004344.1_g000013 Rmu_sc0004344.1_g000021 Rmu_sc0004344.1_g000027 Rmu_sc0004656.1_g000001 Rmu_sc0006098.1_g000002 Rmu_sc0006098.1_g000007 Rmu_sc0007106.1_g000005 Rmu_sc0007106.1_g000009 Rmu_sc0010912.1_g000001 Rmu_sc0021576.1_g000001 Rmu_sc0031470.1_g000001
rosa_roxburghii Rroxscaffold_2G00122810 Rroxscaffold_2G00123600 Rroxscaffold_2G00124270 Rroxscaffold_2G00124320 Rroxscaffold_2G00124350 Rroxscaffold_2G00136690 Rroxscaffold_2G00136740 Rroxscaffold_2G00136750 Rroxscaffold_2G00136760
rosa_rugosa Rorug02G0139000 Rorug02G0139100 Rorug02G0139200 Rorug02G0139300 Rorug02G0139700 Rorug02G0139900 Rorug02G0221400 Rorug02G0221900 Rorug02G0222100 Rorug02G0231700 Rorug02G0231800 Rorug02G0238400 Rorug02G0238500 Rorug05G0413800 Rorug06G0369500 Rorug07G0161900 Rorug07G0309500.1
rosa_samantha Rh2AG190700 Rh2AG279600 Rh2BG201600 Rh2BG201900 Rh2BG202200 Rh2BG288600 Rh2BG290400 Rh2BG290600 Rh2BG291000 Rh2BG291100 Rh2BG291200 Rh2BG291300 Rh2CG195400 Rh2DG196900 Rh2DG197400 Rh2DG197700 Rh2DG283900 Rh2DG285600 Rh2DG285700 Rh2DG286000 Rh2DG286100 Rh2DG286200 Rh2DG286300 Rh2DG305000 Rh2DG305100 Rh2DG305200 Rh2DG305400 Rh5DG500100 Rh6AG481700 Rh6BG491200 Rh6DG482200
rosa_wichuraiana Rw2G014970 Rw2G015010 Rw2G015030 Rw2G022240 Rw2G022250 Rw2G022290 Rw2G022300 Rw2G022310 Rw2G022320 Rw5G034260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 838
AclWI GGATC 3 cut(s) 381, 522, 829
AcuI CTGAAG 2 cut(s) 282, 792
AcvI CACGTG 1 cut(s) 500
AdeI CACNNNGTG 1 cut(s) 230
AfaI GTAC 2 cut(s) 820, 916
AfiI CCNNNNNNNGG 3 cut(s) 131, 369, 370
AflIII ACRYGT 1 cut(s) 435
AgsI TTSAA 3 cut(s) 700, 857, 926
AleI CACNNNNGTG 2 cut(s) 350, 353
AluBI AGCT 2 cut(s) 544, 941
AluI AGCT 2 cut(s) 544, 941
Alw26I GTCTC 1 cut(s) 247
AlwI GGATC 3 cut(s) 381, 522, 829
AlwNI CAGNNNCTG 1 cut(s) 793
Ama87I CYCGRG 1 cut(s) 442
AoxI GGCC 4 cut(s) 133, 159, 196, 618
AspLEI GCGC 3 cut(s) 384, 404, 668
AspS9I GGNCC 3 cut(s) 160, 168, 197
AsuHPI GGTGA 3 cut(s) 46, 265, 745
AvaI CYCGRG 1 cut(s) 442
AvaII GGWCC 1 cut(s) 168
BarI GAAGNNNNNNTAC 2 cut(s) 790, 822
BbrPI CACGTG 1 cut(s) 500
BccI CCATC 9 cut(s) 65, 124, 144, 150, 171, 186, 590, 730, 748
BceAI ACGGC 1 cut(s) 378
BclI TGATCA 1 cut(s) 51
BcoDI GTCTC 1 cut(s) 247
BfaI CTAG 1 cut(s) 426
BfoI RGCGCY 1 cut(s) 405
BglI GCCNNNNNGGC 1 cut(s) 399
BglII AGATCT 1 cut(s) 634
Bme18I GGWCC 1 cut(s) 168
BmeT110I CYCGRG 1 cut(s) 442
BmgT120I GGNCC 3 cut(s) 160, 168, 197
BmsI GCATC 3 cut(s) 456, 748, 943
BpuEI CTTGAG 1 cut(s) 544
Bsa29I ATCGAT 1 cut(s) 780
BsaAI YACGTR 1 cut(s) 500
BsaBI GATNNNNATC 1 cut(s) 56
Bsc4I CCNNNNNNNGG 3 cut(s) 131, 369, 370
Bse1I ACTGG 2 cut(s) 383, 912
Bse8I GATNNNNATC 1 cut(s) 56
BseCI ATCGAT 1 cut(s) 780
BseGI GGATG 3 cut(s) 42, 759, 763
BseJI GATNNNNATC 1 cut(s) 56
BseLI CCNNNNNNNGG 3 cut(s) 131, 369, 370
BseMII CTCAG 5 cut(s) 531, 693, 714, 785, 861
BseNI ACTGG 2 cut(s) 383, 912
BsgI GTGCAG 1 cut(s) 4
BshFI GGCC 4 cut(s) 135, 161, 198, 620
BshVI ATCGAT 1 cut(s) 780
BsiHKCI CYCGRG 1 cut(s) 442
BslFI GGGAC 1 cut(s) 346
BslI CCNNNNNNNGG 3 cut(s) 131, 369, 370
BsmAI GTCTC 1 cut(s) 247
BsmFI GGGAC 1 cut(s) 346
BsmI GAATGC 1 cut(s) 761
BsnI GGCC 4 cut(s) 135, 161, 198, 620
BsoBI CYCGRG 1 cut(s) 442
Bsp143I GATC 8 cut(s) 51, 74, 373, 527, 634, 777, 811, 834
BspACI CCGC 1 cut(s) 838
BspANI GGCC 4 cut(s) 135, 161, 198, 620
BspCNI CTCAG 5 cut(s) 532, 692, 715, 786, 862
BspDI ATCGAT 1 cut(s) 780
BspHI TCATGA 1 cut(s) 639
BspPI GGATC 3 cut(s) 381, 522, 829
BsrI ACTGG 2 cut(s) 383, 912
BssMI GATC 8 cut(s) 51, 74, 373, 527, 634, 777, 811, 834
Bst4CI ACNGT 5 cut(s) 89, 156, 302, 352, 627
Bst6I CTCTTC 4 cut(s) 17, 250, 575, 858
BstBAI YACGTR 1 cut(s) 500
BstC8I GCNNGC 2 cut(s) 318, 322
BstDEI CTNAG 6 cut(s) 540, 679, 723, 747, 794, 870
BstF5I GGATG 3 cut(s) 42, 759, 763
BstH2I RGCGCY 1 cut(s) 405
BstHHI GCGC 3 cut(s) 384, 404, 668
BstKTI GATC 8 cut(s) 54, 77, 376, 530, 637, 780, 814, 837
BstMAI GTCTC 1 cut(s) 247
BstMBI GATC 8 cut(s) 51, 74, 373, 527, 634, 777, 811, 834
BstMWI GCNNNNNNNGC 2 cut(s) 390, 399
BstNSI RCATGY 2 cut(s) 439, 604
BstX2I RGATCY 2 cut(s) 527, 634
BstXI CCANNNNNNTGG 1 cut(s) 355
BstYI RGATCY 2 cut(s) 527, 634
Bsu15I ATCGAT 1 cut(s) 780
BsuRI GGCC 4 cut(s) 135, 161, 198, 620
BsuTUI ATCGAT 1 cut(s) 780
BtsCI GGATG 3 cut(s) 42, 759, 763
BtsIMutI CAGTG 3 cut(s) 348, 376, 879
Cac8I GCNNGC 2 cut(s) 318, 322
CaiI CAGNNNCTG 1 cut(s) 793
CciI TCATGA 1 cut(s) 639
CfoI GCGC 3 cut(s) 384, 404, 668
Cfr13I GGNCC 3 cut(s) 160, 168, 197
ClaI ATCGAT 1 cut(s) 780
Csp6I GTAC 2 cut(s) 819, 915
CviAII CATG 7 cut(s) 313, 331, 436, 532, 601, 640, 945
CviQI GTAC 2 cut(s) 819, 915
DdeI CTNAG 6 cut(s) 540, 679, 723, 747, 794, 870
DpnI GATC 8 cut(s) 53, 76, 375, 529, 636, 779, 813, 836
DpnII GATC 8 cut(s) 51, 74, 373, 527, 634, 777, 811, 834
DraIII CACNNNGTG 1 cut(s) 230
Eam1104I CTCTTC 4 cut(s) 17, 250, 575, 858
EarI CTCTTC 4 cut(s) 17, 250, 575, 858
EciI GGCGGA 1 cut(s) 827
Eco32I GATATC 1 cut(s) 412
Eco47I GGWCC 1 cut(s) 168
Eco57I CTGAAG 2 cut(s) 282, 792
Eco72I CACGTG 1 cut(s) 500
Eco88I CYCGRG 1 cut(s) 442
EcoRV GATATC 1 cut(s) 412
EcoT22I ATGCAT 1 cut(s) 763
FaeI CATG 7 cut(s) 316, 334, 439, 535, 604, 643, 948
FalI AAGNNNNNCTT 2 cut(s) 506, 538
FaqI GGGAC 1 cut(s) 346
FatI CATG 7 cut(s) 312, 330, 435, 531, 600, 639, 944
FauNDI CATATG 2 cut(s) 367, 658
FbaI TGATCA 1 cut(s) 51
FokI GGATG 3 cut(s) 29, 766, 770
FspBI CTAG 1 cut(s) 426
GlaI GCGC 3 cut(s) 383, 403, 667
HaeII RGCGCY 1 cut(s) 405
HaeIII GGCC 4 cut(s) 135, 161, 198, 620
HhaI GCGC 3 cut(s) 384, 404, 668
Hin1II CATG 7 cut(s) 316, 334, 439, 535, 604, 643, 948
Hin6I GCGC 3 cut(s) 382, 402, 666
HinP1I GCGC 3 cut(s) 382, 402, 666
HinfI GANTC 4 cut(s) 359, 483, 790, 860
HphI GGTGA 3 cut(s) 46, 265, 745
Hpy166II GTNNAC 1 cut(s) 520
Hpy188I TCNGA 9 cut(s) 168, 482, 541, 607, 632, 682, 795, 811, 816
Hpy188III TCNNGA 5 cut(s) 49, 442, 451, 640, 857
Hpy8I GTNNAC 1 cut(s) 520
HpyAV CCTTC 3 cut(s) 181, 448, 724
HpyCH4III ACNGT 5 cut(s) 89, 156, 302, 352, 627
HpyCH4IV ACGT 1 cut(s) 499
HpyCH4V TGCA 6 cut(s) 21, 320, 512, 761, 769, 934
HpyF10VI GCNNNNNNNGC 2 cut(s) 390, 399
HpyF3I CTNAG 6 cut(s) 540, 679, 723, 747, 794, 870
HpySE526I ACGT 1 cut(s) 499
Hsp92II CATG 7 cut(s) 316, 334, 439, 535, 604, 643, 948
HspAI GCGC 3 cut(s) 382, 402, 666
Ksp22I TGATCA 1 cut(s) 51
Kzo9I GATC 8 cut(s) 51, 74, 373, 527, 634, 777, 811, 834
LpnPI CCDG 9 cut(s) 199, 213, 278, 306, 364, 436, 561, 882, 893
LweI GCATC 3 cut(s) 456, 748, 943
MaeI CTAG 1 cut(s) 426
MaeII ACGT 1 cut(s) 499
MalI GATC 8 cut(s) 53, 76, 375, 529, 636, 779, 813, 836
MboI GATC 8 cut(s) 51, 74, 373, 527, 634, 777, 811, 834
MboII GAAGA 9 cut(s) 4, 7, 31, 237, 275, 515, 592, 739, 845
MfeI CAATTG 2 cut(s) 255, 470
MflI RGATCY 2 cut(s) 527, 634
MluCI AATT 4 cut(s) 126, 255, 470, 888
MlyI GAGTC 2 cut(s) 368, 477
Mph1103I ATGCAT 1 cut(s) 763
MseI TTAA 1 cut(s) 552
MslI CAYNNNNRTG 3 cut(s) 350, 353, 560
MunI CAATTG 2 cut(s) 255, 470
Mva1269I GAATGC 1 cut(s) 761
MwoI GCNNNNNNNGC 2 cut(s) 390, 399
NdeI CATATG 2 cut(s) 367, 658
NdeII GATC 8 cut(s) 51, 74, 373, 527, 634, 777, 811, 834
NlaIII CATG 7 cut(s) 316, 334, 439, 535, 604, 643, 948
NsiI ATGCAT 1 cut(s) 763
NspI RCATGY 2 cut(s) 439, 604
OliI CACNNNNGTG 2 cut(s) 350, 353
PaeR7I CTCGAG 1 cut(s) 442
PagI TCATGA 1 cut(s) 639
PciI ACATGT 1 cut(s) 435
PctI GAATGC 1 cut(s) 761
PfeI GAWTC 2 cut(s) 790, 860
PflFI GACNNNGTC 1 cut(s) 461
PleI GAGTC 2 cut(s) 367, 477
PmaCI CACGTG 1 cut(s) 500
PmlI CACGTG 1 cut(s) 500
PpsI GAGTC 2 cut(s) 367, 477
Ppu21I YACGTR 1 cut(s) 500
PscI ACATGT 1 cut(s) 435
PspCI CACGTG 1 cut(s) 500
PspPI GGNCC 3 cut(s) 160, 168, 197
PstNI CAGNNNCTG 1 cut(s) 793
PsuI RGATCY 2 cut(s) 527, 634
PsyI GACNNNGTC 1 cut(s) 461
RsaI GTAC 2 cut(s) 820, 916
RsaNI GTAC 2 cut(s) 819, 915
RseI CAYNNNNRTG 3 cut(s) 350, 353, 560
SaqAI TTAA 1 cut(s) 552
Sau3AI GATC 8 cut(s) 51, 74, 373, 527, 634, 777, 811, 834
Sau96I GGNCC 3 cut(s) 160, 168, 197
SchI GAGTC 2 cut(s) 368, 477
SfaNI GCATC 3 cut(s) 456, 748, 943
Sfr274I CTCGAG 1 cut(s) 442
SinI GGWCC 1 cut(s) 168
SlaI CTCGAG 1 cut(s) 442
SmiMI CAYNNNNRTG 3 cut(s) 350, 353, 560
SmlI CTYRAG 2 cut(s) 442, 523
SmoI CTYRAG 2 cut(s) 442, 523
Sse9I AATT 4 cut(s) 126, 255, 470, 888
SsiI CCGC 1 cut(s) 838
SspMI CTAG 1 cut(s) 426
TaaI ACNGT 5 cut(s) 89, 156, 302, 352, 627
TaiI ACGT 1 cut(s) 502
TaqI TCGA 3 cut(s) 73, 443, 780
TasI AATT 4 cut(s) 126, 255, 470, 888
TatI WGTACW 2 cut(s) 818, 914
TfiI GAWTC 2 cut(s) 790, 860
Tru1I TTAA 1 cut(s) 552
Tru9I TTAA 1 cut(s) 552
TscAI CASTG 3 cut(s) 355, 383, 886
TspDTI ATGAA 3 cut(s) 31, 237, 301
TspRI CASTG 3 cut(s) 355, 383, 886
Tth111I GACNNNGTC 1 cut(s) 461
VpaK11BI GGWCC 1 cut(s) 168
XceI RCATGY 2 cut(s) 439, 604
XhoI CTCGAG 1 cut(s) 442
XspI CTAG 1 cut(s) 426
Zsp2I ATGCAT 1 cut(s) 763
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.