Rmu_sc0021576.1_g000001

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021576.1
Physical Location & Seq
Forward (+)
19 .. 342
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021576.1_g000001.1.cds

Sequence Viewer

Length: 324 bp
atgatcaatgcgtgggccatacacagagatccaacgttgtgggatgatcctgaaagcttcaagcctgagaggtttgcaaacggtggagaagagccatacaagctcatgccatttggacaaggaagaagggcttgccctggcatgggcttggcccaacgtgtggttggcttggctttgggatcattgattcaatgtttcgattgggaaaaagtcagtgagatgaaggttgatatgactgaaggtaaaggactcacaatgcctaaagctgtgccactggaggctatgtgcaaagcacgcccaattgtgaacaaggttctctcttag

Protein Analysis

107

Amino Acids

11.89

Weight (kDa)

7.7

Isoelectric Point (pI)

41.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000218)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G66540 AT1G66540 AT4G37340 AT4G37360 AT4G37370 AT5G36220 AT5G36220
fragaria_vesca FvH4_1g16862 FvH4_1g16870 FvH4_1g16871 FvH4_1g16920 FvH4_1g16921 FvH4_1g16930 FvH4_1g23681 FvH4_1g23710
malus_domestica MD03G1281500.v1.1 MD08G1089700.v1.1 MD15G1074700.v1.1 MD15G1289800.v1.1 MD15G1290300.v1.1
prunus_persica Prupe.6G226600_v2.0.a1 Prupe.6G226800_v2.0.a1 Prupe.6G226900_v2.0.a1 Prupe.6G227000_v2.0.a1 Prupe.6G227100_v2.0.a1 Prupe.6G227300_v2.0.a1 Prupe.6G227400_v2.0.a1
pyrus_communis pycom15g25350 pycom15g25360 pycom15g25370 pycom15g25400
rosa_chinensis RchiOBHm_Chr2g0106831 RchiOBHm_Chr2g0106851 RchiOBHm_Chr2g0106901 RchiOBHm_Chr2g0106911 RchiOBHm_Chr2g0106971 RchiOBHm_Chr2g0106991 RchiOBHm_Chr2g0119331 RchiOBHm_Chr2g0119351 RchiOBHm_Chr2g0119391 RchiOBHm_Chr2g0119411 RchiOBHm_Chr2g0119481 RchiOBHm_Chr2g0119541 RchiOBHm_Chr5g0076421
rosa_laevigata RLG00000012204 RLG00000017542 RLG00000017543 RLG00000017547 RLG00000017549 RLG00000018145 RLG00000018146 RLG00000018148 RLG00000018462 RLG00000018464 RLG00000018465 RLG00000018468 RLG00000018470 RLG00000018471 RLG00000018539 RLG00000018540 RLG00000018592
rosa_multiflora Rmu_co8030410.1_g000001 Rmu_co8333451.1_g000001 Rmu_co8389363.1_g000001 Rmu_sc0001801.1_g000006 Rmu_sc0001801.1_g000023 Rmu_sc0001801.1_g000036 Rmu_sc0002788.1_g000013 Rmu_sc0002868.1_g000014 Rmu_sc0004344.1_g000013 Rmu_sc0004344.1_g000021 Rmu_sc0004344.1_g000027 Rmu_sc0004656.1_g000001 Rmu_sc0006098.1_g000002 Rmu_sc0006098.1_g000007 Rmu_sc0007106.1_g000005 Rmu_sc0007106.1_g000009 Rmu_sc0010912.1_g000001 Rmu_sc0021576.1_g000001 Rmu_sc0031470.1_g000001
rosa_roxburghii Rroxscaffold_2G00122810 Rroxscaffold_2G00123600 Rroxscaffold_2G00124270 Rroxscaffold_2G00124320 Rroxscaffold_2G00124350 Rroxscaffold_2G00136690 Rroxscaffold_2G00136740 Rroxscaffold_2G00136750 Rroxscaffold_2G00136760
rosa_rugosa Rorug02G0139000 Rorug02G0139100 Rorug02G0139200 Rorug02G0139300 Rorug02G0139700 Rorug02G0139900 Rorug02G0221400 Rorug02G0221900 Rorug02G0222100 Rorug02G0231700 Rorug02G0231800 Rorug02G0238400 Rorug02G0238500 Rorug05G0413800 Rorug06G0369500 Rorug07G0161900 Rorug07G0309500.1
rosa_samantha Rh2AG190700 Rh2AG279600 Rh2BG201600 Rh2BG201900 Rh2BG202200 Rh2BG288600 Rh2BG290400 Rh2BG290600 Rh2BG291000 Rh2BG291100 Rh2BG291200 Rh2BG291300 Rh2CG195400 Rh2DG196900 Rh2DG197400 Rh2DG197700 Rh2DG283900 Rh2DG285600 Rh2DG285700 Rh2DG286000 Rh2DG286100 Rh2DG286200 Rh2DG286300 Rh2DG305000 Rh2DG305100 Rh2DG305200 Rh2DG305400 Rh5DG500100 Rh6AG481700 Rh6BG491200 Rh6DG482200
rosa_wichuraiana Rw2G014970 Rw2G015010 Rw2G015030 Rw2G022240 Rw2G022250 Rw2G022290 Rw2G022300 Rw2G022310 Rw2G022320 Rw5G034260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 160
AclI AACGTT 1 cut(s) 35
AclWI GGATC 3 cut(s) 23, 41, 187
AcuI CTGAAG 1 cut(s) 258
AfiI CCNNNNNNNGG 3 cut(s) 142, 143, 160
AflIII ACRYGT 1 cut(s) 157
AgsI TTSAA 2 cut(s) 61, 191
AjnI CCWGG 1 cut(s) 136
AluBI AGCT 3 cut(s) 57, 103, 266
AluI AGCT 3 cut(s) 57, 103, 266
AlwI GGATC 3 cut(s) 23, 41, 187
AoxI GGCC 2 cut(s) 15, 150
AspS9I GGNCC 2 cut(s) 15, 151
BciT130I CCWGG 1 cut(s) 138
BclI TGATCA 1 cut(s) 3
Bme1390I CCNGG 1 cut(s) 138
BmgT120I GGNCC 2 cut(s) 15, 151
BmrFI CCNGG 1 cut(s) 138
BpmI CTGGAG 1 cut(s) 296
BsaJI CCNNGG 1 cut(s) 136
BsaXI ACNNNNNCTCC 2 cut(s) 269, 299
Bsc4I CCNNNNNNNGG 3 cut(s) 142, 143, 160
Bse1I ACTGG 1 cut(s) 279
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 3 cut(s) 142, 143, 160
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 279
BshFI GGCC 2 cut(s) 17, 152
BslI CCNNNNNNNGG 3 cut(s) 142, 143, 160
BsnI GGCC 2 cut(s) 17, 152
Bsp143I GATC 4 cut(s) 3, 28, 46, 179
BspANI GGCC 2 cut(s) 17, 152
BspCNI CTCAG 1 cut(s) 58
BspPI GGATC 3 cut(s) 23, 41, 187
BspQI GCTCTTC 1 cut(s) 84
BsrI ACTGG 1 cut(s) 279
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 4 cut(s) 3, 28, 46, 179
Bst2UI CCWGG 1 cut(s) 138
Bst4CI ACNGT 1 cut(s) 83
Bst6I CTCTTC 1 cut(s) 84
BstC8I GCNNGC 2 cut(s) 133, 295
BstDEI CTNAG 2 cut(s) 66, 321
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 4 cut(s) 6, 31, 49, 182
BstMBI GATC 4 cut(s) 3, 28, 46, 179
BstMWI GCNNNNNNNGC 2 cut(s) 100, 294
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstX2I RGATCY 1 cut(s) 28
BstXI CCANNNNNNTGG 1 cut(s) 39
BstYI RGATCY 1 cut(s) 28
BsuRI GGCC 2 cut(s) 17, 152
BtsCI GGATG 1 cut(s) 49
BtsIMutI CAGTG 2 cut(s) 220, 272
Cac8I GCNNGC 2 cut(s) 133, 295
Cfr13I GGNCC 2 cut(s) 15, 151
CviAII CATG 2 cut(s) 106, 142
DdeI CTNAG 2 cut(s) 66, 321
DpnI GATC 4 cut(s) 5, 30, 48, 181
DpnII GATC 4 cut(s) 3, 28, 46, 179
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
Eco57I CTGAAG 1 cut(s) 258
EcoRII CCWGG 1 cut(s) 136
FaeI CATG 2 cut(s) 109, 145
FaiI YATR 6 cut(s) 20, 97, 107, 143, 233, 284
FalI AAGNNNNNCTT 2 cut(s) 115, 147
FatI CATG 2 cut(s) 105, 141
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 56
GsuI CTGGAG 1 cut(s) 296
HaeIII GGCC 2 cut(s) 17, 152
Hin1II CATG 2 cut(s) 109, 145
HindIII AAGCTT 1 cut(s) 55
HinfI GANTC 2 cut(s) 187, 249
Hpy166II GTNNAC 1 cut(s) 307
Hpy188III TCNNGA 1 cut(s) 50
Hpy8I GTNNAC 1 cut(s) 307
HpyAV CCTTC 3 cut(s) 120, 217, 233
HpyCH4III ACNGT 1 cut(s) 83
HpyCH4IV ACGT 2 cut(s) 35, 157
HpyCH4V TGCA 2 cut(s) 77, 288
HpyF10VI GCNNNNNNNGC 2 cut(s) 100, 294
HpyF3I CTNAG 2 cut(s) 66, 321
HpySE526I ACGT 2 cut(s) 35, 157
Hsp92II CATG 2 cut(s) 109, 145
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 4 cut(s) 3, 28, 46, 179
LguI GCTCTTC 1 cut(s) 84
LpnPI CCDG 5 cut(s) 63, 78, 123, 150, 260
MaeII ACGT 2 cut(s) 35, 157
MalI GATC 4 cut(s) 5, 30, 48, 181
MboI GATC 4 cut(s) 3, 28, 46, 179
MboII GAAGA 2 cut(s) 101, 135
MfeI CAATTG 1 cut(s) 300
MflI RGATCY 1 cut(s) 28
MluCI AATT 1 cut(s) 300
MlyI GAGTC 1 cut(s) 243
MmeI TCCRAC 1 cut(s) 56
MnlI CCTC 2 cut(s) 63, 271
MspR9I CCNGG 1 cut(s) 138
MunI CAATTG 1 cut(s) 300
MvaI CCWGG 1 cut(s) 138
MwoI GCNNNNNNNGC 2 cut(s) 100, 294
NdeII GATC 4 cut(s) 3, 28, 46, 179
NlaIII CATG 2 cut(s) 109, 145
PciSI GCTCTTC 1 cut(s) 84
PfeI GAWTC 1 cut(s) 187
PflMI CCANNNNNTGG 1 cut(s) 160
PleI GAGTC 1 cut(s) 243
PpsI GAGTC 1 cut(s) 243
Psp1406I AACGTT 1 cut(s) 35
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
PspPI GGNCC 2 cut(s) 15, 151
PsuI RGATCY 1 cut(s) 28
SapI GCTCTTC 1 cut(s) 84
Sau3AI GATC 4 cut(s) 3, 28, 46, 179
Sau96I GGNCC 2 cut(s) 15, 151
SchI GAGTC 1 cut(s) 243
ScrFI CCNGG 1 cut(s) 138
SetI ASST 9 cut(s) 38, 59, 74, 105, 160, 228, 244, 268, 315
Sse9I AATT 1 cut(s) 300
StyD4I CCNGG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 83
TaiI ACGT 2 cut(s) 38, 160
TaqI TCGA 1 cut(s) 198
TasI AATT 1 cut(s) 300
TfiI GAWTC 1 cut(s) 187
TscAI CASTG 2 cut(s) 220, 279
TspDTI ATGAA 1 cut(s) 236
TspRI CASTG 2 cut(s) 220, 279
Van91I CCANNNNNTGG 1 cut(s) 160
XcmI CCANNNNNNNNNTGG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.