Rroxscaffold_3G00257910

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001199
Physical Location & Seq
Reverse (-)
52203639 .. 52208925
5287 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00257910.1

Sequence Viewer

Length: 348 bp
ATGGTCCAAACTTTGAATTTCAATGGTCGCTCCGATCAAATAGCGATAGTTACACGCAGGCGTCCTCCGTGGGGTGGAGCCGAAGTCCGTGTTCGTAATGACACTTTGGTCGGCGGCATGGTGGACTACATGGAAACTAGAGATTTTAGGGTTTCCTATTTAGTTGATGGCTTGGAGTGTTTGGGCCATTTGGGTCTCGAACTGGACTGTGGGCCTCATTCTTGGGCTTGGATTGAGGTTCTTATACTTATCTTTTTGTGTAATATGTTAACATTACTCTCAAAAGTAGCTGAGAGTAATGTCCAACTAGCGGGGTCCACACTCTGTGTTTGGGGAGATACGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.85

Weight (kDa)

4.89

Isoelectric Point (pI)

32.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 107
AciI CCGC 2 cut(s) 114, 311
AcsI RAATTY 1 cut(s) 16
AcyI GRCGYC 1 cut(s) 61
AdeI CACNNNGTG 1 cut(s) 326
AfiI CCNNNNNNNGG 3 cut(s) 71, 74, 310
AgsI TTSAA 2 cut(s) 16, 22
AluBI AGCT 1 cut(s) 290
AluI AGCT 1 cut(s) 290
Alw26I GTCTC 1 cut(s) 200
AoxI GGCC 2 cut(s) 184, 212
ApoI RAATTY 1 cut(s) 16
AspS9I GGNCC 4 cut(s) 4, 184, 212, 315
AvaII GGWCC 2 cut(s) 4, 315
BccI CCATC 1 cut(s) 161
BcoDI GTCTC 1 cut(s) 200
BfaI CTAG 2 cut(s) 138, 308
BisI GCNGC 1 cut(s) 115
BlsI GCNGC 1 cut(s) 116
Bme18I GGWCC 2 cut(s) 4, 315
BmgT120I GGNCC 4 cut(s) 4, 184, 212, 315
BmiI GGNNCC 2 cut(s) 79, 316
BsaHI GRCGYC 1 cut(s) 61
BsaI GGTCTC 1 cut(s) 200
BsaJI CCNNGG 1 cut(s) 68
BsaXI ACNNNNNCTCC 2 cut(s) 69, 99
Bsc4I CCNNNNNNNGG 3 cut(s) 71, 74, 310
Bse1I ACTGG 1 cut(s) 207
BseDI CCNNGG 1 cut(s) 68
BseLI CCNNNNNNNGG 3 cut(s) 71, 74, 310
BseMII CTCAG 1 cut(s) 282
BseNI ACTGG 1 cut(s) 207
BshFI GGCC 2 cut(s) 186, 214
BslI CCNNNNNNNGG 3 cut(s) 71, 74, 310
BsmAI GTCTC 1 cut(s) 200
BsnI GGCC 2 cut(s) 186, 214
Bso31I GGTCTC 1 cut(s) 200
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 2 cut(s) 114, 311
BspANI GGCC 2 cut(s) 186, 214
BspCNI CTCAG 1 cut(s) 283
BspLI GGNNCC 2 cut(s) 79, 316
BspTNI GGTCTC 1 cut(s) 200
BsrI ACTGG 1 cut(s) 207
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 1 cut(s) 34
BssNI GRCGYC 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 209
BstACI GRCGYC 1 cut(s) 61
BstC8I GCNNGC 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 291
BstDSI CCRYGG 1 cut(s) 68
BstKTI GATC 1 cut(s) 37
BstMAI GTCTC 1 cut(s) 200
BstMBI GATC 1 cut(s) 34
BsuRI GGCC 2 cut(s) 186, 214
BtgI CCRYGG 1 cut(s) 68
Cac8I GCNNGC 1 cut(s) 59
Cfr13I GGNCC 4 cut(s) 4, 184, 212, 315
CseI GACGC 1 cut(s) 50
CviAII CATG 2 cut(s) 118, 130
CviJI RGCY 6 cut(s) 80, 171, 186, 214, 227, 290
CviKI_1 RGCY 6 cut(s) 80, 171, 186, 214, 227, 290
DdeI CTNAG 1 cut(s) 291
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
DraIII CACNNNGTG 1 cut(s) 326
DrdI GACNNNNNNGTC 1 cut(s) 107
DseDI GACNNNNNNGTC 1 cut(s) 107
Eco31I GGTCTC 1 cut(s) 200
Eco47I GGWCC 2 cut(s) 4, 315
FaeI CATG 2 cut(s) 121, 133
FaiI YATR 4 cut(s) 119, 131, 245, 266
FatI CATG 2 cut(s) 117, 129
FauI CCCGC 1 cut(s) 304
Fnu4HI GCNGC 1 cut(s) 115
Fsp4HI GCNGC 1 cut(s) 115
FspBI CTAG 2 cut(s) 138, 308
GluI GCNGC 1 cut(s) 115
HaeIII GGCC 2 cut(s) 186, 214
HgaI GACGC 1 cut(s) 50
Hin1I GRCGYC 1 cut(s) 61
Hin1II CATG 2 cut(s) 121, 133
HincII GTYRAC 1 cut(s) 270
HindII GTYRAC 1 cut(s) 270
HpaI GTTAAC 1 cut(s) 270
Hpy166II GTNNAC 3 cut(s) 124, 270, 318
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 197
Hpy8I GTNNAC 3 cut(s) 124, 270, 318
HpyCH4III ACNGT 1 cut(s) 209
HpyF3I CTNAG 1 cut(s) 291
Hsp92I GRCGYC 1 cut(s) 61
Hsp92II CATG 2 cut(s) 121, 133
KspAI GTTAAC 1 cut(s) 270
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 2 cut(s) 35, 77
LpnPI CCDG 2 cut(s) 43, 188
MaeI CTAG 2 cut(s) 138, 308
MaeIII GTNAC 1 cut(s) 49
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MluCI AATT 1 cut(s) 16
MmeI TCCRAC 1 cut(s) 328
MnlI CCTC 3 cut(s) 75, 225, 229
MseI TTAA 1 cut(s) 269
NdeII GATC 1 cut(s) 34
NlaIII CATG 2 cut(s) 121, 133
NlaIV GGNNCC 2 cut(s) 79, 316
PkrI GCNGC 1 cut(s) 116
PspN4I GGNNCC 2 cut(s) 79, 316
PspPI GGNCC 4 cut(s) 4, 184, 212, 315
SaqAI TTAA 1 cut(s) 269
SatI GCNGC 1 cut(s) 115
Sau3AI GATC 1 cut(s) 34
Sau96I GGNCC 4 cut(s) 4, 184, 212, 315
SetI ASST 2 cut(s) 240, 292
SinI GGWCC 2 cut(s) 4, 315
Sse9I AATT 1 cut(s) 16
SsiI CCGC 2 cut(s) 114, 311
SspMI CTAG 2 cut(s) 138, 308
TaaI ACNGT 1 cut(s) 209
TaqI TCGA 1 cut(s) 198
TasI AATT 1 cut(s) 16
TauI GCSGC 1 cut(s) 117
Tru1I TTAA 1 cut(s) 269
Tru9I TTAA 1 cut(s) 269
TspGWI ACGGA 2 cut(s) 57, 77
VpaK11BI GGWCC 2 cut(s) 4, 315
XapI RAATTY 1 cut(s) 16
XspI CTAG 2 cut(s) 138, 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.