Rh7CG499100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
67374894 .. 67375172
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG499100.1

Sequence Viewer

Length: 279 bp
ATGACAGTTTGGTGTTGGATTTGCTTCGTTCTTGGAAGCGATGAGGATTCGATGGTCTGCCTTGACGACACGACTAAGATTTTGATGTCCAATTCGGATTTGGGTAAAAGTCCTAATGCGGCGAAGGTGTCTACTTCGGTGGTGGTGTGGCGGTCTGCTAAAGTGCAACCAGATTTGCTTTTTGGCTTTTTGGTTGGTAGAATGGTGGACAAGGATGATGGCGATCCCGACATCTATACTGACGAGGGTTGTCTCTCAATGGACGATGGTGGTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

9.99

Weight (kDa)

4.05

Isoelectric Point (pI)

28.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 131
AciI CCGC 2 cut(s) 119, 151
AclWI GGATC 1 cut(s) 218
Alw26I GTCTC 1 cut(s) 257
AlwI GGATC 1 cut(s) 218
ArsI GACNNNNNNTTYG 2 cut(s) 64, 96
BccI CCATC 3 cut(s) 46, 212, 260
BcgI CGANNNNNNTGC 1 cut(s) 254
BcoDI GTCTC 1 cut(s) 257
BisI GCNGC 1 cut(s) 120
BlsI GCNGC 1 cut(s) 121
BsaBI GATNNNNATC 1 cut(s) 222
Bse8I GATNNNNATC 1 cut(s) 222
BseGI GGATG 1 cut(s) 220
BseJI GATNNNNATC 1 cut(s) 222
BsmAI GTCTC 1 cut(s) 257
Bsp143I GATC 1 cut(s) 223
BspACI CCGC 2 cut(s) 119, 151
BspPI GGATC 1 cut(s) 218
BssMI GATC 1 cut(s) 223
Bst4CI ACNGT 1 cut(s) 7
BstDEI CTNAG 2 cut(s) 75, 276
BstF5I GGATG 1 cut(s) 220
BstKTI GATC 1 cut(s) 226
BstMAI GTCTC 1 cut(s) 257
BstMBI GATC 1 cut(s) 223
BtgZI GCGATG 1 cut(s) 54
BtsCI GGATG 1 cut(s) 220
CviJI RGCY 1 cut(s) 186
CviKI_1 RGCY 1 cut(s) 186
DdeI CTNAG 2 cut(s) 75, 276
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
FaiI YATR 1 cut(s) 237
FblI GTMKAC 1 cut(s) 131
Fnu4HI GCNGC 1 cut(s) 120
FokI GGATG 1 cut(s) 227
Fsp4HI GCNGC 1 cut(s) 120
GluI GCNGC 1 cut(s) 120
HinfI GANTC 1 cut(s) 47
Hpy166II GTNNAC 2 cut(s) 132, 208
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 2 cut(s) 132, 208
HpyAV CCTTC 1 cut(s) 118
HpyCH4III ACNGT 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 166
HpyF3I CTNAG 2 cut(s) 75, 276
Kzo9I GATC 1 cut(s) 223
LpnPI CCDG 1 cut(s) 183
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MluCI AATT 1 cut(s) 91
MnlI CCTC 2 cut(s) 37, 238
NdeII GATC 1 cut(s) 223
PfeI GAWTC 1 cut(s) 47
PkrI GCNGC 1 cut(s) 121
SatI GCNGC 1 cut(s) 120
Sau3AI GATC 1 cut(s) 223
SetI ASST 1 cut(s) 129
SgeI CNNG 7 cut(s) 44, 74, 82, 182, 223, 239, 256
Sse9I AATT 1 cut(s) 91
SsiI CCGC 2 cut(s) 119, 151
TaaI ACNGT 1 cut(s) 7
TaqI TCGA 1 cut(s) 50
TasI AATT 1 cut(s) 91
TauI GCSGC 1 cut(s) 122
TfiI GAWTC 1 cut(s) 47
XcmI CCANNNNNNNNNTGG 1 cut(s) 97
XmiI GTMKAC 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.