Rh6AG060400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0001199
Physical Location & Seq
Forward (+)
9052774 .. 9060596
7823 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG060400.1

Sequence Viewer

Length: 162 bp
ATGGTAACATCCAAAATCAATAAAGCCATCATTAACTCTGTGTCAGATGGTGAAGGATCCAAATCCAACTCAGAGGATTATCCATTAATCAGAGACACAGACTCAGAAGATGAAGAGAGTGGTTCCTCCAAAAATGAGGCATATCAAGTTCTCATGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.78

Weight (kDa)

4.21

Isoelectric Point (pI)

39.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 51, 64
Alw26I GTCTC 1 cut(s) 87
AlwI GGATC 2 cut(s) 51, 64
AseI ATTAAT 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 62
BamHI GGATCC 1 cut(s) 56
BccI CCATC 2 cut(s) 35, 41
BcoDI GTCTC 1 cut(s) 87
BmiI GGNNCC 2 cut(s) 58, 124
BsaBI GATNNNNATC 1 cut(s) 61
Bse8I GATNNNNATC 1 cut(s) 61
BseGI GGATG 1 cut(s) 8
BseJI GATNNNNATC 1 cut(s) 61
BseMII CTCAG 2 cut(s) 84, 117
BsmAI GTCTC 1 cut(s) 87
Bsp143I GATC 1 cut(s) 56
BspCNI CTCAG 2 cut(s) 83, 116
BspHI TCATGA 1 cut(s) 153
BspLI GGNNCC 2 cut(s) 58, 124
BspPI GGATC 2 cut(s) 51, 64
BssMI GATC 1 cut(s) 56
Bst6I CTCTTC 1 cut(s) 108
BstDEI CTNAG 2 cut(s) 70, 103
BstF5I GGATG 1 cut(s) 8
BstKTI GATC 1 cut(s) 59
BstMAI GTCTC 1 cut(s) 87
BstMBI GATC 1 cut(s) 56
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BtsCI GGATG 1 cut(s) 8
CciI TCATGA 1 cut(s) 153
CviAII CATG 1 cut(s) 154
CviJI RGCY 1 cut(s) 26
CviKI_1 RGCY 1 cut(s) 26
DdeI CTNAG 2 cut(s) 70, 103
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
FaeI CATG 1 cut(s) 157
FaiI YATR 2 cut(s) 142, 155
FatI CATG 1 cut(s) 153
Hin1II CATG 1 cut(s) 157
HinfI GANTC 1 cut(s) 101
HphI GGTGA 1 cut(s) 62
Hpy188I TCNGA 4 cut(s) 46, 73, 92, 106
Hpy188III TCNNGA 1 cut(s) 154
HpyAV CCTTC 1 cut(s) 47
HpyF3I CTNAG 2 cut(s) 70, 103
Hsp92II CATG 1 cut(s) 157
Kzo9I GATC 1 cut(s) 56
MaeIII GTNAC 1 cut(s) 4
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MboII GAAGA 2 cut(s) 119, 125
MflI RGATCY 1 cut(s) 56
MlyI GAGTC 1 cut(s) 95
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 3 cut(s) 67, 130, 136
MseI TTAA 2 cut(s) 33, 86
NdeII GATC 1 cut(s) 56
NlaIII CATG 1 cut(s) 157
NlaIV GGNNCC 2 cut(s) 58, 124
PagI TCATGA 1 cut(s) 153
PleI GAGTC 1 cut(s) 95
PpsI GAGTC 1 cut(s) 95
PshBI ATTAAT 1 cut(s) 86
PspN4I GGNNCC 2 cut(s) 58, 124
PsuI RGATCY 1 cut(s) 56
SaqAI TTAA 2 cut(s) 33, 86
Sau3AI GATC 1 cut(s) 56
SchI GAGTC 1 cut(s) 95
SgeI CNNG 1 cut(s) 158
Tru1I TTAA 2 cut(s) 33, 86
Tru9I TTAA 2 cut(s) 33, 86
TspDTI ATGAA 1 cut(s) 126
VspI ATTAAT 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.