Rh4CG254800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
50533325 .. 50538014
4690 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG254800.1

Sequence Viewer

Length: 228 bp
ATGATGGGTCGGTTTGTACCGAATCTTAATATGTCGGGTGCTTTGGAATATTCCAAGGATAAAACTATCATGTTTGAAATGGTCACCTCCCTCTTCTCTGCCCTGGTGTCAGATGGTGAAGAATCCAAATCCAACTCAGAGGATTATCCATTAATCAGAGACACAGACTCAGAAGATGAAGAGAGTGGTTCCTCCAAAAATGAGGCATATCAAGTTCTCATGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.4

Weight (kDa)

4.13

Isoelectric Point (pI)

41.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 18
AgsI TTSAA 1 cut(s) 77
AjnI CCWGG 1 cut(s) 102
Alw26I GTCTC 1 cut(s) 153
AseI ATTAAT 1 cut(s) 152
AsuHPI GGTGA 2 cut(s) 76, 128
BccI CCATC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 104
BcoDI GTCTC 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 104
BmiI GGNNCC 1 cut(s) 190
BmrFI CCNGG 1 cut(s) 104
BsaJI CCNNGG 2 cut(s) 54, 102
BseBI CCWGG 1 cut(s) 104
BseDI CCNNGG 2 cut(s) 54, 102
BseMII CTCAG 2 cut(s) 150, 183
BsmAI GTCTC 1 cut(s) 153
BspCNI CTCAG 2 cut(s) 149, 182
BspHI TCATGA 1 cut(s) 219
BspLI GGNNCC 1 cut(s) 190
BssECI CCNNGG 2 cut(s) 54, 102
BssT1I CCWWGG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 104
Bst6I CTCTTC 2 cut(s) 98, 174
BstDEI CTNAG 2 cut(s) 136, 169
BstEII GGTNACC 1 cut(s) 82
BstMAI GTCTC 1 cut(s) 153
BstNI CCWGG 1 cut(s) 104
BstPI GGTNACC 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 102
CciI TCATGA 1 cut(s) 219
Csp6I GTAC 1 cut(s) 17
CviAII CATG 2 cut(s) 70, 220
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 2 cut(s) 136, 169
Eam1104I CTCTTC 2 cut(s) 98, 174
EarI CTCTTC 2 cut(s) 98, 174
Eco130I CCWWGG 1 cut(s) 54
Eco91I GGTNACC 1 cut(s) 82
EcoO65I GGTNACC 1 cut(s) 82
EcoRII CCWGG 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 2 cut(s) 73, 223
FaiI YATR 4 cut(s) 32, 71, 208, 221
FatI CATG 2 cut(s) 69, 219
Hin1II CATG 2 cut(s) 73, 223
HinfI GANTC 3 cut(s) 22, 122, 167
HphI GGTGA 2 cut(s) 76, 128
Hpy188I TCNGA 4 cut(s) 112, 139, 158, 172
Hpy188III TCNNGA 1 cut(s) 220
HpyF3I CTNAG 2 cut(s) 136, 169
Hsp92II CATG 2 cut(s) 73, 223
LpnPI CCDG 2 cut(s) 89, 116
MaeIII GTNAC 1 cut(s) 82
MboII GAAGA 4 cut(s) 85, 131, 185, 191
MlyI GAGTC 1 cut(s) 161
MmeI TCCRAC 1 cut(s) 156
MnlI CCTC 5 cut(s) 97, 101, 133, 196, 202
MseI TTAA 2 cut(s) 27, 152
MspR9I CCNGG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 104
NlaIII CATG 2 cut(s) 73, 223
NlaIV GGNNCC 1 cut(s) 190
NmuCI GTSAC 1 cut(s) 82
PagI TCATGA 1 cut(s) 219
PfeI GAWTC 2 cut(s) 22, 122
PleI GAGTC 1 cut(s) 161
PpsI GAGTC 1 cut(s) 161
PshBI ATTAAT 1 cut(s) 152
Psp6I CCWGG 1 cut(s) 102
PspEI GGTNACC 1 cut(s) 82
PspGI CCWGG 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 190
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
SaqAI TTAA 2 cut(s) 27, 152
SchI GAGTC 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 104
SetI ASST 1 cut(s) 89
SgeI CNNG 6 cut(s) 48, 67, 82, 115, 116, 224
SspI AATATT 1 cut(s) 50
StyD4I CCNGG 1 cut(s) 102
StyI CCWWGG 1 cut(s) 54
TfiI GAWTC 2 cut(s) 22, 122
Tru1I TTAA 2 cut(s) 27, 152
Tru9I TTAA 2 cut(s) 27, 152
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 192
VspI ATTAAT 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.