Rh6AG022800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
2620021 .. 2620338
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG022800.1

Sequence Viewer

Length: 318 bp
ATGACTCTGGCATTGTCTCAGGTTCTAATTTCTCTTGATGACAGTTTGGTGTTGGATTGCTTCGTTCTTGGAAGCGATGGGGATCCGATGGTCTGCCTTGACGACAAGTCTGGGATTTTGATGTCCAATTCGGATTTGAGTAAAAGACCTAATGCGGTGAAGATGTCTGCTTCAGTGGTGGTGTGGCGGTCTGCTGCAGTCCAACCAAATTTGCTTATTGGCTTTTTGGGTGGTAGAATGGTGGACAAGGATGATGGCGATCCTGACATCTATACGGACGAGGGTTGTCTCTCAGTGGACGATGGTGCTGCTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.14

Weight (kDa)

4.05

Isoelectric Point (pI)

33.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 155, 187
AclWI GGATC 3 cut(s) 77, 90, 254
AcsI RAATTY 1 cut(s) 208
AcuI CTGAAG 1 cut(s) 156
AhdI GACNNNNNGTC 1 cut(s) 106
Alw26I GTCTC 2 cut(s) 21, 293
AlwI GGATC 3 cut(s) 77, 90, 254
ApeKI GCWGC 2 cut(s) 194, 308
ApoI RAATTY 1 cut(s) 208
AsuHPI GGTGA 1 cut(s) 169
BamHI GGATCC 1 cut(s) 82
BbvI GCAGC 2 cut(s) 181, 295
BccI CCATC 4 cut(s) 71, 82, 248, 296
BcgI CGANNNNNNTGC 1 cut(s) 290
BcoDI GTCTC 2 cut(s) 21, 293
BfmI CTRYAG 1 cut(s) 195
BisI GCNGC 2 cut(s) 195, 309
BlsI GCNGC 2 cut(s) 196, 310
BmeRI GACNNNNNGTC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 84
BsaBI GATNNNNATC 2 cut(s) 81, 258
Bse8I GATNNNNATC 2 cut(s) 81, 258
BseGI GGATG 1 cut(s) 256
BseJI GATNNNNATC 2 cut(s) 81, 258
BseMII CTCAG 2 cut(s) 32, 306
BseXI GCAGC 2 cut(s) 181, 295
BsmAI GTCTC 2 cut(s) 21, 293
Bsp143I GATC 2 cut(s) 82, 259
BspACI CCGC 2 cut(s) 155, 187
BspCNI CTCAG 2 cut(s) 31, 305
BspLI GGNNCC 1 cut(s) 84
BspMAI CTGCAG 1 cut(s) 199
BspPI GGATC 3 cut(s) 77, 90, 254
BssMI GATC 2 cut(s) 82, 259
Bst4CI ACNGT 1 cut(s) 44
BstDEI CTNAG 2 cut(s) 18, 292
BstF5I GGATG 1 cut(s) 256
BstKTI GATC 2 cut(s) 85, 262
BstMAI GTCTC 2 cut(s) 21, 293
BstMBI GATC 2 cut(s) 82, 259
BstSFI CTRYAG 1 cut(s) 195
BstV1I GCAGC 2 cut(s) 181, 295
BstX2I RGATCY 1 cut(s) 82
BstYI RGATCY 1 cut(s) 82
BtgZI GCGATG 1 cut(s) 90
BtsCI GGATG 1 cut(s) 256
BtsIMutI CAGTG 2 cut(s) 180, 300
CviJI RGCY 1 cut(s) 222
CviKI_1 RGCY 1 cut(s) 222
DdeI CTNAG 2 cut(s) 18, 292
DpnI GATC 2 cut(s) 84, 261
DpnII GATC 2 cut(s) 82, 259
DriI GACNNNNNGTC 1 cut(s) 106
Eam1105I GACNNNNNGTC 1 cut(s) 106
Eco57I CTGAAG 1 cut(s) 156
FaiI YATR 1 cut(s) 273
Fnu4HI GCNGC 2 cut(s) 195, 309
FokI GGATG 1 cut(s) 263
Fsp4HI GCNGC 2 cut(s) 195, 309
GluI GCNGC 2 cut(s) 195, 309
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 169
Hpy166II GTNNAC 2 cut(s) 244, 298
Hpy188I TCNGA 2 cut(s) 87, 133
Hpy188III TCNNGA 2 cut(s) 35, 263
Hpy8I GTNNAC 2 cut(s) 244, 298
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 197
HpyF3I CTNAG 2 cut(s) 18, 292
Kzo9I GATC 2 cut(s) 82, 259
LpnPI CCDG 3 cut(s) 5, 96, 276
Lsp1109I GCAGC 2 cut(s) 181, 295
MalI GATC 2 cut(s) 84, 261
MboI GATC 2 cut(s) 82, 259
MboII GAAGA 1 cut(s) 172
MflI RGATCY 1 cut(s) 82
MluCI AATT 3 cut(s) 27, 127, 208
MmeI TCCRAC 2 cut(s) 33, 226
MnlI CCTC 1 cut(s) 274
NdeII GATC 2 cut(s) 82, 259
NlaIV GGNNCC 1 cut(s) 84
PkrI GCNGC 2 cut(s) 196, 310
PspN4I GGNNCC 1 cut(s) 84
PstI CTGCAG 1 cut(s) 199
PsuI RGATCY 1 cut(s) 82
SatI GCNGC 2 cut(s) 195, 309
Sau3AI GATC 2 cut(s) 82, 259
SetI ASST 2 cut(s) 24, 151
SfcI CTRYAG 1 cut(s) 195
Sse9I AATT 3 cut(s) 27, 127, 208
SsiI CCGC 2 cut(s) 155, 187
TaaI ACNGT 1 cut(s) 44
TasI AATT 3 cut(s) 27, 127, 208
TscAI CASTG 2 cut(s) 180, 300
TseI GCWGC 2 cut(s) 194, 308
TspGWI ACGGA 1 cut(s) 290
TspRI CASTG 2 cut(s) 180, 300
XapI RAATTY 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.