Rh2DG608700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
84197530 .. 84206567
9038 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG608700.1

Sequence Viewer

Length: 294 bp
ATGAATGAGACTTTAATCTTGCAAGTTACATCAGGCCTGAGTTTGCACGGTTTGGTGGTGATCAGTTCATTTTATATAGTGCCTGAGGTACTTGCTGGGGCTGATGTTGAGTGCAGGGCATCCAACTCAGAGGATTATCCATTAATCAGAAACACAGACTCAGAAGATGAAGAGAGTGATTTTTCCGAAAATGAGAATGCAATTGGTATCAGGATCAGAAGCATATTGGTTATGATCTTAAAGGGAAAAAAGATTGGTGGAAAAATTGGAGAAATTGCAATCCTTTCTTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.51

Weight (kDa)

4.51

Isoelectric Point (pI)

51.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 221
AfaI GTAC 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 2
AlwI GGATC 1 cut(s) 221
AoxI GGCC 1 cut(s) 34
AseI ATTAAT 1 cut(s) 143
AsuHPI GGTGA 1 cut(s) 70
AxyI CCTNAGG 1 cut(s) 84
BclI TGATCA 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 2
BfaI CTAG 1 cut(s) 292
BmsI GCATC 1 cut(s) 128
Bse21I CCTNAGG 1 cut(s) 84
BseGI GGATG 1 cut(s) 119
BseMII CTCAG 4 cut(s) 29, 75, 141, 174
BseYI CCCAGC 1 cut(s) 95
BsgI GTGCAG 1 cut(s) 133
BshFI GGCC 1 cut(s) 36
BsmAI GTCTC 1 cut(s) 2
BsmI GAATGC 1 cut(s) 202
BsnI GGCC 1 cut(s) 36
Bsp143I GATC 3 cut(s) 60, 213, 234
BspANI GGCC 1 cut(s) 36
BspCNI CTCAG 4 cut(s) 30, 76, 140, 173
BspPI GGATC 1 cut(s) 221
BssMI GATC 3 cut(s) 60, 213, 234
Bst4CI ACNGT 1 cut(s) 50
Bst6I CTCTTC 1 cut(s) 165
BstDEI CTNAG 4 cut(s) 38, 84, 127, 160
BstF5I GGATG 1 cut(s) 119
BstKTI GATC 3 cut(s) 63, 216, 237
BstMAI GTCTC 1 cut(s) 2
BstMBI GATC 3 cut(s) 60, 213, 234
Bsu36I CCTNAGG 1 cut(s) 84
BsuRI GGCC 1 cut(s) 36
BtsCI GGATG 1 cut(s) 119
Csp6I GTAC 1 cut(s) 89
CviJI RGCY 2 cut(s) 36, 101
CviKI_1 RGCY 2 cut(s) 36, 101
CviQI GTAC 1 cut(s) 89
DdeI CTNAG 4 cut(s) 38, 84, 127, 160
DpnI GATC 3 cut(s) 62, 215, 236
DpnII GATC 3 cut(s) 60, 213, 234
Eam1104I CTCTTC 1 cut(s) 165
EarI CTCTTC 1 cut(s) 165
Eco147I AGGCCT 1 cut(s) 36
Eco81I CCTNAGG 1 cut(s) 84
FaiI YATR 4 cut(s) 75, 77, 224, 233
FbaI TGATCA 1 cut(s) 60
FokI GGATG 1 cut(s) 106
FspBI CTAG 1 cut(s) 292
GsaI CCCAGC 1 cut(s) 99
HaeIII GGCC 1 cut(s) 36
HinfI GANTC 1 cut(s) 158
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 5 cut(s) 130, 149, 163, 187, 218
Hpy188III TCNNGA 1 cut(s) 211
HpyCH4III ACNGT 1 cut(s) 50
HpyCH4V TGCA 5 cut(s) 22, 46, 114, 200, 278
HpyF3I CTNAG 4 cut(s) 38, 84, 127, 160
Ksp22I TGATCA 1 cut(s) 60
Kzo9I GATC 3 cut(s) 60, 213, 234
LpnPI CCDG 6 cut(s) 18, 50, 81, 96, 100, 196
LweI GCATC 1 cut(s) 128
MaeI CTAG 1 cut(s) 292
MaeIII GTNAC 1 cut(s) 25
MalI GATC 3 cut(s) 62, 215, 236
MboI GATC 3 cut(s) 60, 213, 234
MboII GAAGA 2 cut(s) 176, 182
MfeI CAATTG 1 cut(s) 201
MluCI AATT 3 cut(s) 201, 264, 273
MlyI GAGTC 1 cut(s) 152
MmeI TCCRAC 1 cut(s) 147
MnlI CCTC 2 cut(s) 79, 124
MseI TTAA 3 cut(s) 14, 143, 239
MunI CAATTG 1 cut(s) 201
Mva1269I GAATGC 1 cut(s) 202
NdeII GATC 3 cut(s) 60, 213, 234
PceI AGGCCT 1 cut(s) 36
PctI GAATGC 1 cut(s) 202
PleI GAGTC 1 cut(s) 152
PpsI GAGTC 1 cut(s) 152
PshBI ATTAAT 1 cut(s) 143
PspFI CCCAGC 1 cut(s) 95
RsaI GTAC 1 cut(s) 90
RsaNI GTAC 1 cut(s) 89
SaqAI TTAA 3 cut(s) 14, 143, 239
Sau3AI GATC 3 cut(s) 60, 213, 234
SchI GAGTC 1 cut(s) 152
SetI ASST 1 cut(s) 90
SfaNI GCATC 1 cut(s) 128
Sse9I AATT 3 cut(s) 201, 264, 273
SseBI AGGCCT 1 cut(s) 36
SspMI CTAG 1 cut(s) 292
StuI AGGCCT 1 cut(s) 36
TaaI ACNGT 1 cut(s) 50
TasI AATT 3 cut(s) 201, 264, 273
Tru1I TTAA 3 cut(s) 14, 143, 239
Tru9I TTAA 3 cut(s) 14, 143, 239
TspDTI ATGAA 3 cut(s) 17, 57, 183
VspI ATTAAT 1 cut(s) 143
XspI CTAG 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.