Rh6CG043600

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
4296513 .. 4298366
1854 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG043600.1

Sequence Viewer

Length: 315 bp
ATGGCTGCGCATGTGGATTGTGTTCTCATTTTACTAGTTCGTCAAGAGGGACAGGCTCTTGTGGGAGAGGTGAACTCTTGGTTAGATGACAACCAGAATTTCCAACTCAGAAAACTGCAAATTGTGGAAGTACATGGCATCAGTAGCACTAAAGCTGGACTAGATTTCATCAAATTTCTGCTTTTAAATTCACCAATGCTTGAGAAGGTGTTTTGCAAGCCTGCATCTCACTATAGTTCTCTGGAACTATTAAAAAAGATGATCCAGTTTAAGCGTTCCTCAGCCCTTGCGGAGATAATCTACTTGGACCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.76

Weight (kDa)

6.82

Isoelectric Point (pI)

34.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBD PF08387 38 - 70 1.9e-06 FBD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 9
AciI CCGC 1 cut(s) 290
AclWI GGATC 1 cut(s) 256
AcsI RAATTY 3 cut(s) 97, 173, 187
AfaI GTAC 1 cut(s) 132
AhlI ACTAGT 1 cut(s) 34
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
AlwI GGATC 1 cut(s) 256
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 3 cut(s) 97, 173, 187
AspLEI GCGC 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 307
AsuHPI GGTGA 2 cut(s) 82, 183
AvaII GGWCC 1 cut(s) 307
BbvCI CCTCAGC 1 cut(s) 280
BcuI ACTAGT 1 cut(s) 34
BfaI CTAG 2 cut(s) 35, 161
BfmI CTRYAG 1 cut(s) 232
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme18I GGWCC 1 cut(s) 307
BmgT120I GGNCC 1 cut(s) 307
BmiI GGNNCC 1 cut(s) 309
BmsI GCATC 2 cut(s) 147, 233
BplI GAGNNNNNCTC 2 cut(s) 59, 91
Bpu10I CCTNAGC 1 cut(s) 280
BpuEI CTTGAG 1 cut(s) 221
Bse1I ACTGG 1 cut(s) 265
BseMII CTCAG 2 cut(s) 121, 294
BseNI ACTGG 1 cut(s) 265
BslFI GGGAC 1 cut(s) 63
BsmFI GGGAC 1 cut(s) 63
Bsp143I GATC 1 cut(s) 261
BspACI CCGC 1 cut(s) 290
BspCNI CTCAG 2 cut(s) 120, 293
BspLI GGNNCC 1 cut(s) 309
BspPI GGATC 1 cut(s) 256
BsrI ACTGG 1 cut(s) 265
BssMI GATC 1 cut(s) 261
BstC8I GCNNGC 2 cut(s) 218, 222
BstDEI CTNAG 2 cut(s) 107, 280
BstHHI GCGC 1 cut(s) 10
BstKTI GATC 1 cut(s) 264
BstMBI GATC 1 cut(s) 261
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstNSI RCATGY 1 cut(s) 14
BstSFI CTRYAG 1 cut(s) 232
Cac8I GCNNGC 2 cut(s) 218, 222
CfoI GCGC 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 307
Csp6I GTAC 1 cut(s) 131
CviAII CATG 3 cut(s) 11, 134, 312
CviJI RGCY 5 cut(s) 5, 56, 155, 220, 284
CviKI_1 RGCY 5 cut(s) 5, 56, 155, 220, 284
CviQI GTAC 1 cut(s) 131
DdeI CTNAG 2 cut(s) 107, 280
DpnI GATC 1 cut(s) 263
DpnII GATC 1 cut(s) 261
DraI TTTAAA 1 cut(s) 186
Eco47I GGWCC 1 cut(s) 307
FaeI CATG 3 cut(s) 14, 137, 315
FaiI YATR 4 cut(s) 12, 135, 234, 313
FaqI GGGAC 1 cut(s) 63
FatI CATG 3 cut(s) 10, 133, 311
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 2 cut(s) 35, 161
FspI TGCGCA 1 cut(s) 9
GlaI GCGC 1 cut(s) 9
GluI GCNGC 1 cut(s) 6
HhaI GCGC 1 cut(s) 10
Hin1II CATG 3 cut(s) 14, 137, 315
Hin6I GCGC 1 cut(s) 8
HinP1I GCGC 1 cut(s) 8
HphI GGTGA 2 cut(s) 82, 183
Hpy166II GTNNAC 1 cut(s) 73
Hpy188I TCNGA 1 cut(s) 110
Hpy188III TCNNGA 2 cut(s) 44, 242
Hpy8I GTNNAC 1 cut(s) 73
HpyAV CCTTC 1 cut(s) 199
HpyCH4V TGCA 3 cut(s) 118, 216, 224
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
HpyF3I CTNAG 2 cut(s) 107, 280
Hsp92II CATG 3 cut(s) 14, 137, 315
HspAI GCGC 1 cut(s) 8
Kzo9I GATC 1 cut(s) 261
LpnPI CCDG 6 cut(s) 38, 107, 141, 227, 234, 278
LweI GCATC 2 cut(s) 147, 233
MaeI CTAG 2 cut(s) 35, 161
MalI GATC 1 cut(s) 263
MboI GATC 1 cut(s) 261
MluCI AATT 4 cut(s) 97, 120, 173, 187
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 3 cut(s) 40, 61, 289
MseI TTAA 3 cut(s) 185, 251, 270
MwoI GCNNNNNNNGC 1 cut(s) 144
NdeII GATC 1 cut(s) 261
NlaIII CATG 3 cut(s) 14, 137, 315
NlaIV GGNNCC 1 cut(s) 309
NsbI TGCGCA 1 cut(s) 9
NspI RCATGY 1 cut(s) 14
PkrI GCNGC 1 cut(s) 7
PspN4I GGNNCC 1 cut(s) 309
PspPI GGNCC 1 cut(s) 307
RsaI GTAC 1 cut(s) 132
RsaNI GTAC 1 cut(s) 131
SaqAI TTAA 3 cut(s) 185, 251, 270
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 261
Sau96I GGNCC 1 cut(s) 307
SetI ASST 3 cut(s) 72, 157, 210
SfaNI GCATC 2 cut(s) 147, 233
SfcI CTRYAG 1 cut(s) 232
SinI GGWCC 1 cut(s) 307
SmlI CTYRAG 1 cut(s) 200
SmoI CTYRAG 1 cut(s) 200
SpeI ACTAGT 1 cut(s) 34
Sse9I AATT 4 cut(s) 97, 120, 173, 187
SsiI CCGC 1 cut(s) 290
SspMI CTAG 2 cut(s) 35, 161
TasI AATT 4 cut(s) 97, 120, 173, 187
TatI WGTACW 1 cut(s) 130
Tru1I TTAA 3 cut(s) 185, 251, 270
Tru9I TTAA 3 cut(s) 185, 251, 270
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 307
XapI RAATTY 3 cut(s) 97, 173, 187
XceI RCATGY 1 cut(s) 14
XspI CTAG 2 cut(s) 35, 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.