MD03G1030900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0001007
Physical Location & Seq
Forward (+)
2499692 .. 2500490
799 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1030900.v1.1.491

Sequence Viewer

Length: 246 bp
ATGGATGAACATATGGAAGATCAACATTCTGAGAAACACCAATTCGAAGAGGAAGAGTTCGAAACTAGTTCATTTTTAAATTATTATTATTATTATTATTATATTCAGTTTGTGTTTTGTATTTTGACTAATATTATGCTTAAATTGAAAATTGGTTTTTATTTCTTGGTTTTTAATTGTTTGTTCTATATTAATAAGGAACATCTCAATGAAGAACTCGCGGACTTGCAATTCCCAAATGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

10.11

Weight (kDa)

4.49

Isoelectric Point (pI)

55.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 221
AciI CCGC 1 cut(s) 221
AgsI TTSAA 1 cut(s) 148
AhlI ACTAGT 1 cut(s) 65
AseI ATTAAT 1 cut(s) 192
AsuII TTCGAA 2 cut(s) 45, 60
BcuI ACTAGT 1 cut(s) 65
BfaI CTAG 1 cut(s) 66
Bpu14I TTCGAA 2 cut(s) 45, 60
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 21
Bsh1236I CGCG 1 cut(s) 221
Bsp119I TTCGAA 2 cut(s) 45, 60
Bsp143I GATC 1 cut(s) 19
BspACI CCGC 1 cut(s) 221
BspCNI CTCAG 1 cut(s) 22
BspFNI CGCG 1 cut(s) 221
BspT104I TTCGAA 2 cut(s) 45, 60
BssMI GATC 1 cut(s) 19
Bst6I CTCTTC 2 cut(s) 42, 48
BstBI TTCGAA 2 cut(s) 45, 60
BstDEI CTNAG 1 cut(s) 30
BstF5I GGATG 1 cut(s) 10
BstFNI CGCG 1 cut(s) 221
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstUI CGCG 1 cut(s) 221
BtsCI GGATG 1 cut(s) 10
DdeI CTNAG 1 cut(s) 30
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
DraI TTTAAA 1 cut(s) 78
Eam1104I CTCTTC 2 cut(s) 42, 48
EarI CTCTTC 2 cut(s) 42, 48
FaiI YATR 5 cut(s) 12, 14, 102, 137, 189
FauNDI CATATG 1 cut(s) 12
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 66
FspEI CC 7 cut(s) 35, 53, 138, 152, 182, 206, 225
Hpy188I TCNGA 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 229
HpyF3I CTNAG 1 cut(s) 30
Kzo9I GATC 1 cut(s) 19
MaeI CTAG 1 cut(s) 66
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 4 cut(s) 29, 59, 65, 224
MluCI AATT 6 cut(s) 41, 79, 143, 150, 175, 230
MnlI CCTC 1 cut(s) 43
MseI TTAA 4 cut(s) 77, 141, 174, 192
MslI CAYNNNNRTG 1 cut(s) 207
MvnI CGCG 1 cut(s) 221
NdeI CATATG 1 cut(s) 12
NdeII GATC 1 cut(s) 19
NspV TTCGAA 2 cut(s) 45, 60
PshBI ATTAAT 1 cut(s) 192
RseI CAYNNNNRTG 1 cut(s) 207
SaqAI TTAA 4 cut(s) 77, 141, 174, 192
Sau3AI GATC 1 cut(s) 19
SfuI TTCGAA 2 cut(s) 45, 60
SgeI CNNG 5 cut(s) 78, 178, 230, 232, 238
SmiMI CAYNNNNRTG 1 cut(s) 207
SpeI ACTAGT 1 cut(s) 65
Sse9I AATT 6 cut(s) 41, 79, 143, 150, 175, 230
SsiI CCGC 1 cut(s) 221
SspI AATATT 1 cut(s) 133
SspMI CTAG 1 cut(s) 66
TaqI TCGA 2 cut(s) 45, 60
TasI AATT 6 cut(s) 41, 79, 143, 150, 175, 230
Tru1I TTAA 4 cut(s) 77, 141, 174, 192
Tru9I TTAA 4 cut(s) 77, 141, 174, 192
TspDTI ATGAA 3 cut(s) 21, 60, 225
VspI ATTAAT 1 cut(s) 192
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.