Rh4BG131400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
22067579 .. 22067968
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG131400.1

Sequence Viewer

Length: 306 bp
ATGGAAGACGATAAAAAAGAGTCCCTTGAATTCAATTCTATGGGTGTTAGTGTAGGTTCTAATGATGGAAAATTTGGCCGATACTTGGGTGGGTTAGCTCGAGATTATAATGTTATTCCGCTCGTCATTAAACCTTGGCCTAAAGTGTCAAGTACTACTAAAGAATCCTTATGGGAGCAAATATATGCAACTATTGAATGGAAACCTAAAGATTTTCCTCGTATGCCTCTCATAAAGCATAACATAATGGAAAGAGTTGCCAAGTATTGGAGAAGTTACAAGAACAGACTTAAGAAAGCTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.88

Weight (kDa)

9.7

Isoelectric Point (pI)

33.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 108
AccB7I CCANNNNNTGG 1 cut(s) 267
AccBSI CCGCTC 1 cut(s) 121
AciI CCGC 1 cut(s) 119
AcoI YGGCCR 1 cut(s) 76
AcsI RAATTY 2 cut(s) 29, 71
AfaI GTAC 1 cut(s) 154
AfiI CCNNNNNNNGG 2 cut(s) 85, 267
AflII CTTAAG 1 cut(s) 290
AgsI TTSAA 3 cut(s) 29, 34, 197
AluBI AGCT 2 cut(s) 98, 299
AluI AGCT 2 cut(s) 98, 299
Ama87I CYCGRG 1 cut(s) 99
AoxI GGCC 2 cut(s) 76, 137
ApoI RAATTY 2 cut(s) 29, 71
AvaI CYCGRG 1 cut(s) 99
BaeI ACNNNNGTAYC 2 cut(s) 73, 106
BbsI GAAGAC 1 cut(s) 12
BccI CCATC 1 cut(s) 59
BfrI CTTAAG 1 cut(s) 290
BmcAI AGTACT 1 cut(s) 154
BmeT110I CYCGRG 1 cut(s) 99
BpiI GAAGAC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 134
Bsc4I CCNNNNNNNGG 2 cut(s) 85, 267
BseDI CCNNGG 1 cut(s) 134
BseLI CCNNNNNNNGG 2 cut(s) 85, 267
BshFI GGCC 2 cut(s) 78, 139
BsiHKCI CYCGRG 1 cut(s) 99
BslFI GGGAC 1 cut(s) 7
BslI CCNNNNNNNGG 2 cut(s) 85, 267
BsmFI GGGAC 1 cut(s) 7
BsnI GGCC 2 cut(s) 78, 139
BsoBI CYCGRG 1 cut(s) 99
BspACI CCGC 1 cut(s) 119
BspANI GGCC 2 cut(s) 78, 139
BspTI CTTAAG 1 cut(s) 290
BsrBI CCGCTC 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 134
BssT1I CCWWGG 1 cut(s) 134
BstAFI CTTAAG 1 cut(s) 290
BstV2I GAAGAC 1 cut(s) 12
BsuRI GGCC 2 cut(s) 78, 139
Csp6I GTAC 1 cut(s) 153
CviJI RGCY 4 cut(s) 78, 98, 139, 299
CviKI_1 RGCY 4 cut(s) 78, 98, 139, 299
CviQI GTAC 1 cut(s) 153
EaeI YGGCCR 1 cut(s) 76
Eco130I CCWWGG 1 cut(s) 134
Eco88I CYCGRG 1 cut(s) 99
EcoRI GAATTC 1 cut(s) 29
EcoT14I CCWWGG 1 cut(s) 134
ErhI CCWWGG 1 cut(s) 134
FaiI YATR 9 cut(s) 41, 108, 172, 184, 186, 224, 233, 240, 245
FalI AAGNNNNNCTT 2 cut(s) 9, 41
FaqI GGGAC 1 cut(s) 7
HaeIII GGCC 2 cut(s) 78, 139
HinfI GANTC 2 cut(s) 20, 164
Hpy188III TCNNGA 1 cut(s) 101
HpyCH4V TGCA 1 cut(s) 188
LmnI GCTCC 1 cut(s) 175
MaeIII GTNAC 1 cut(s) 275
MbiI CCGCTC 1 cut(s) 121
MboII GAAGA 1 cut(s) 17
MluCI AATT 3 cut(s) 29, 34, 71
MlyI GAGTC 1 cut(s) 29
MnlI CCTC 2 cut(s) 228, 237
MseI TTAA 3 cut(s) 129, 291, 304
MspCI CTTAAG 1 cut(s) 290
PaeR7I CTCGAG 1 cut(s) 99
PfeI GAWTC 1 cut(s) 164
PflMI CCANNNNNTGG 1 cut(s) 267
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
PsiI TTATAA 1 cut(s) 108
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SaqAI TTAA 3 cut(s) 129, 291, 304
ScaI AGTACT 1 cut(s) 154
SchI GAGTC 1 cut(s) 29
SetI ASST 5 cut(s) 58, 100, 136, 208, 301
Sfr274I CTCGAG 1 cut(s) 99
SlaI CTCGAG 1 cut(s) 99
SmlI CTYRAG 2 cut(s) 99, 290
SmoI CTYRAG 2 cut(s) 99, 290
Sse9I AATT 3 cut(s) 29, 34, 71
SsiI CCGC 1 cut(s) 119
StyI CCWWGG 1 cut(s) 134
TaqI TCGA 1 cut(s) 100
TasI AATT 3 cut(s) 29, 34, 71
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 3 cut(s) 129, 291, 304
Tru9I TTAA 3 cut(s) 129, 291, 304
Van91I CCANNNNNTGG 1 cut(s) 267
Vha464I CTTAAG 1 cut(s) 290
XapI RAATTY 2 cut(s) 29, 71
XhoI CTCGAG 1 cut(s) 99
ZrmI AGTACT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.