Rh7CG518900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0001007
Physical Location & Seq
Reverse (-)
69758189 .. 69758446
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG518900.1

Sequence Viewer

Length: 258 bp
ATGCGAGAAAGAGCATATGTTGCAGTGATGGGACCTGAGAAACGTCACAAAGTTCGCAGTTATGGACTAGGTGTAATACCTGATATGGTGCCTTATCTTCAAATTGATGGTAGCTCATCATCACACAGATCACATGGAAGACACTATGCTCACTTGCAGTCACAATTTATGGAGTTAGAATCCAAGTACCAACAACAACAAGAGCAAGCCCAGGTGCAACAAGTTCAAACTCAGGAACAACTCTTGCAAACCCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Transposase_24

Protein Analysis

85

Amino Acids

9.93

Weight (kDa)

8.13

Isoelectric Point (pI)

79.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 88
AfaI GTAC 1 cut(s) 188
AgsI TTSAA 2 cut(s) 101, 227
AjnI CCWGG 1 cut(s) 210
AluBI AGCT 1 cut(s) 114
AluI AGCT 1 cut(s) 114
AspS9I GGNCC 1 cut(s) 32
AvaII GGWCC 1 cut(s) 32
BanI GGYRCC 1 cut(s) 88
BbsI GAAGAC 1 cut(s) 145
BccI CCATC 2 cut(s) 22, 101
BciT130I CCWGG 1 cut(s) 212
BfaI CTAG 1 cut(s) 68
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 32
BmiI GGNNCC 2 cut(s) 33, 90
BmrFI CCNGG 1 cut(s) 212
BpiI GAAGAC 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 210
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 1 cut(s) 210
BseMII CTCAG 2 cut(s) 27, 245
BshNI GGYRCC 1 cut(s) 88
BslFI GGGAC 1 cut(s) 45
BsmFI GGGAC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 128
BspCNI CTCAG 2 cut(s) 28, 244
BspLI GGNNCC 2 cut(s) 33, 90
BspT107I GGYRCC 1 cut(s) 88
BssECI CCNNGG 1 cut(s) 210
BssMI GATC 1 cut(s) 128
Bst2UI CCWGG 1 cut(s) 212
BstAPI GCANNNNNTGC 1 cut(s) 20
BstC8I GCNNGC 1 cut(s) 207
BstDEI CTNAG 2 cut(s) 36, 231
BstKTI GATC 1 cut(s) 131
BstMBI GATC 1 cut(s) 128
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstNI CCWGG 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 210
BstV2I GAAGAC 1 cut(s) 145
BtsI GCAGTG 1 cut(s) 30
BtsIMutI CAGTG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 207
Cfr13I GGNCC 1 cut(s) 32
Csp6I GTAC 1 cut(s) 187
CviAII CATG 1 cut(s) 134
CviJI RGCY 2 cut(s) 114, 209
CviKI_1 RGCY 2 cut(s) 114, 209
CviQI GTAC 1 cut(s) 187
DdeI CTNAG 2 cut(s) 36, 231
DpnI GATC 1 cut(s) 130
DpnII GATC 1 cut(s) 128
Eco47I GGWCC 1 cut(s) 32
EcoO109I RGGNCCY 1 cut(s) 32
EcoRII CCWGG 1 cut(s) 210
FaeI CATG 1 cut(s) 137
FaiI YATR 7 cut(s) 16, 18, 63, 86, 135, 147, 170
FaqI GGGAC 1 cut(s) 45
FatI CATG 1 cut(s) 133
FauNDI CATATG 1 cut(s) 16
FspBI CTAG 1 cut(s) 68
Hin1II CATG 1 cut(s) 137
HinfI GANTC 1 cut(s) 179
Hpy188III TCNNGA 1 cut(s) 233
HpyCH4IV ACGT 1 cut(s) 43
HpyCH4V TGCA 4 cut(s) 23, 157, 217, 247
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpyF3I CTNAG 2 cut(s) 36, 231
HpySE526I ACGT 1 cut(s) 43
Hsp92II CATG 1 cut(s) 137
Kzo9I GATC 1 cut(s) 128
LpnPI CCDG 5 cut(s) 48, 93, 197, 218, 224
MaeI CTAG 1 cut(s) 68
MaeII ACGT 1 cut(s) 43
MaeIII GTNAC 2 cut(s) 44, 159
MalI GATC 1 cut(s) 130
MboI GATC 1 cut(s) 128
MboII GAAGA 2 cut(s) 89, 150
MluCI AATT 2 cut(s) 102, 164
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
MwoI GCNNNNNNNGC 1 cut(s) 20
NdeI CATATG 1 cut(s) 16
NdeII GATC 1 cut(s) 128
NlaIII CATG 1 cut(s) 137
NlaIV GGNNCC 2 cut(s) 33, 90
NmuCI GTSAC 2 cut(s) 44, 159
PfeI GAWTC 1 cut(s) 179
PpuMI RGGWCCY 1 cut(s) 32
Psp5II RGGWCCY 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspN4I GGNNCC 2 cut(s) 33, 90
PspPI GGNCC 1 cut(s) 32
PspPPI RGGWCCY 1 cut(s) 32
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
Sau3AI GATC 1 cut(s) 128
Sau96I GGNCC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 212
SetI ASST 6 cut(s) 37, 46, 73, 82, 116, 216
SinI GGWCC 1 cut(s) 32
Sse9I AATT 2 cut(s) 102, 164
SspMI CTAG 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 210
TaiI ACGT 1 cut(s) 46
TasI AATT 2 cut(s) 102, 164
TfiI GAWTC 1 cut(s) 179
TscAI CASTG 1 cut(s) 30
TseFI GTSAC 2 cut(s) 44, 159
Tsp45I GTSAC 2 cut(s) 44, 159
TspRI CASTG 1 cut(s) 30
VpaK11BI GGWCC 1 cut(s) 32
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.