Rh5DG495800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0001007
Physical Location & Seq
Forward (+)
77897351 .. 77897689
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG495800.1

Sequence Viewer

Length: 210 bp
ATGAGTTCTGGAGATAATTCGTGGGAAGGTGATATAGAAGGACTAAGTGGTTCTACTAATGGTACATGCAAAACTACCAAAGTACGTGGTAAAGGAACGTGTACTTGGATGGAAGATAATAAAAAAGAATTCCTTGAGTTCAATTCTATGGGTGTTAGTGTAGGTTCTAATGATGGAAAATTTGGCCAATACTTGGGTGGGTTAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.3

Weight (kDa)

4.85

Isoelectric Point (pI)

24.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 193
AcoI YGGCCR 1 cut(s) 184
AcsI RAATTY 2 cut(s) 128, 179
AfaI GTAC 3 cut(s) 64, 84, 103
AfiI CCNNNNNNNGG 1 cut(s) 193
AflIII ACRYGT 1 cut(s) 98
AgsI TTSAA 1 cut(s) 142
AjuI GAANNNNNNNTTGG 2 cut(s) 88, 120
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
AoxI GGCC 1 cut(s) 184
ApoI RAATTY 2 cut(s) 128, 179
AsuHPI GGTGA 1 cut(s) 41
BalI TGGCCA 1 cut(s) 186
BccI CCATC 2 cut(s) 103, 167
BpmI CTGGAG 1 cut(s) 30
BpuEI CTTGAG 1 cut(s) 155
BsaAI YACGTR 1 cut(s) 86
Bsc4I CCNNNNNNNGG 1 cut(s) 193
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 193
BshFI GGCC 1 cut(s) 186
BslI CCNNNNNNNGG 1 cut(s) 193
BsnI GGCC 1 cut(s) 186
BspANI GGCC 1 cut(s) 186
BstBAI YACGTR 1 cut(s) 86
BstDEI CTNAG 1 cut(s) 44
BstF5I GGATG 1 cut(s) 114
BstNSI RCATGY 1 cut(s) 69
BsuRI GGCC 1 cut(s) 186
BtsCI GGATG 1 cut(s) 114
Csp6I GTAC 3 cut(s) 63, 83, 102
CspCI CAANNNNNGTGG 2 cut(s) 67, 102
CviAII CATG 1 cut(s) 66
CviJI RGCY 2 cut(s) 186, 206
CviKI_1 RGCY 2 cut(s) 186, 206
CviQI GTAC 3 cut(s) 63, 83, 102
DdeI CTNAG 1 cut(s) 44
EaeI YGGCCR 1 cut(s) 184
EcoRI GAATTC 1 cut(s) 128
FaeI CATG 1 cut(s) 69
FaiI YATR 3 cut(s) 35, 67, 149
FalI AAGNNNNNCTT 2 cut(s) 117, 149
FatI CATG 1 cut(s) 65
FokI GGATG 1 cut(s) 121
GsuI CTGGAG 1 cut(s) 30
HaeIII GGCC 1 cut(s) 186
Hin1II CATG 1 cut(s) 69
HphI GGTGA 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 9
Hpy8I GTNNAC 1 cut(s) 102
HpyAV CCTTC 2 cut(s) 20, 32
HpyCH4IV ACGT 2 cut(s) 85, 98
HpyCH4V TGCA 1 cut(s) 69
HpyF3I CTNAG 1 cut(s) 44
HpySE526I ACGT 2 cut(s) 85, 98
Hsp92II CATG 1 cut(s) 69
MaeII ACGT 2 cut(s) 85, 98
MboII GAAGA 1 cut(s) 125
MlsI TGGCCA 1 cut(s) 186
MluCI AATT 4 cut(s) 16, 128, 142, 179
MluNI TGGCCA 1 cut(s) 186
Mox20I TGGCCA 1 cut(s) 186
MscI TGGCCA 1 cut(s) 186
Msp20I TGGCCA 1 cut(s) 186
NlaIII CATG 1 cut(s) 69
NspI RCATGY 1 cut(s) 69
PflMI CCANNNNNTGG 1 cut(s) 193
Ppu21I YACGTR 1 cut(s) 86
RsaI GTAC 3 cut(s) 64, 84, 103
RsaNI GTAC 3 cut(s) 63, 83, 102
SetI ASST 5 cut(s) 31, 88, 101, 166, 208
SgeI CNNG 8 cut(s) 21, 33, 78, 98, 111, 117, 146, 205
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 4 cut(s) 16, 128, 142, 179
TaiI ACGT 2 cut(s) 88, 101
TasI AATT 4 cut(s) 16, 128, 142, 179
TatI WGTACW 1 cut(s) 101
Van91I CCANNNNNTGG 1 cut(s) 193
XapI RAATTY 2 cut(s) 128, 179
XceI RCATGY 1 cut(s) 69
XcmI CCANNNNNNNNNTGG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.