Rh5DG495900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0001007
Physical Location & Seq
Forward (+)
77897922 .. 77898086
165 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG495900.1

Sequence Viewer

Length: 165 bp
ATGGAAAGAGTTGCTAAATATTGGAGAAACTACAGGAATAGACTTAAGAAAGCTCATTATGATCCCAAAATAGGCACACCAGAACGTTGGGTGTGTGAGAATAAAGATGTGGACGCAGCTGAATGGCGCGAAATGATGAAATATTGGGATAAAGAAAGGACAACA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Transposase_24

Protein Analysis

55

Amino Acids

6.98

Weight (kDa)

9.41

Isoelectric Point (pI)

22.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 129
AclI AACGTT 1 cut(s) 85
AclWI GGATC 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 71
AflII CTTAAG 1 cut(s) 44
AluBI AGCT 2 cut(s) 53, 119
AluI AGCT 2 cut(s) 53, 119
AlwI GGATC 1 cut(s) 56
ApeKI GCWGC 1 cut(s) 116
AspLEI GCGC 1 cut(s) 129
BbvI GCAGC 1 cut(s) 128
BfmI CTRYAG 1 cut(s) 31
BfrI CTTAAG 1 cut(s) 44
BisI GCNGC 1 cut(s) 117
BlsI GCNGC 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 71
BseLI CCNNNNNNNGG 1 cut(s) 71
BseXI GCAGC 1 cut(s) 128
Bsh1236I CGCG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 71
Bsp143I GATC 1 cut(s) 61
BspFNI CGCG 1 cut(s) 129
BspPI GGATC 1 cut(s) 56
BspTI CTTAAG 1 cut(s) 44
BssMI GATC 1 cut(s) 61
BstAFI CTTAAG 1 cut(s) 44
BstFNI CGCG 1 cut(s) 129
BstHHI GCGC 1 cut(s) 129
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 31
BstUI CGCG 1 cut(s) 129
BstV1I GCAGC 1 cut(s) 128
BstXI CCANNNNNNTGG 1 cut(s) 87
CfoI GCGC 1 cut(s) 129
CseI GACGC 1 cut(s) 122
CviJI RGCY 2 cut(s) 53, 119
CviKI_1 RGCY 2 cut(s) 53, 119
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
FaiI YATR 1 cut(s) 60
Fnu4HI GCNGC 1 cut(s) 117
Fsp4HI GCNGC 1 cut(s) 117
GlaI GCGC 1 cut(s) 128
GluI GCNGC 1 cut(s) 117
HgaI GACGC 1 cut(s) 122
HhaI GCGC 1 cut(s) 129
Hin6I GCGC 1 cut(s) 127
HinP1I GCGC 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 112
Hpy8I GTNNAC 1 cut(s) 112
HpyCH4IV ACGT 1 cut(s) 85
HpySE526I ACGT 1 cut(s) 85
HspAI GCGC 1 cut(s) 127
Kzo9I GATC 1 cut(s) 61
LpnPI CCDG 2 cut(s) 19, 93
Lsp1109I GCAGC 1 cut(s) 128
MaeII ACGT 1 cut(s) 85
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MseI TTAA 1 cut(s) 45
MspA1I CMGCKG 1 cut(s) 119
MspCI CTTAAG 1 cut(s) 44
MvnI CGCG 1 cut(s) 129
NdeII GATC 1 cut(s) 61
PkrI GCNGC 1 cut(s) 118
Psp1406I AACGTT 1 cut(s) 85
PvuII CAGCTG 1 cut(s) 119
SaqAI TTAA 1 cut(s) 45
SatI GCNGC 1 cut(s) 117
Sau3AI GATC 1 cut(s) 61
SetI ASST 3 cut(s) 55, 88, 121
SfcI CTRYAG 1 cut(s) 31
SgeI CNNG 3 cut(s) 46, 92, 140
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
SspI AATATT 2 cut(s) 20, 143
TaiI ACGT 1 cut(s) 88
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TseI GCWGC 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 152
Vha464I CTTAAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.