Rh7AG070500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
4953737 .. 4962001
8265 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG070500.1

Sequence Viewer

Length: 192 bp
ATGGTGACGTGTACGAAGGGTATCGCTAGGGGTGCATTACACCTTGTAGGAGATAAAGCCTGTTGCCTCCAACTCCTAACACCCCAAAGATTGTCAGGAGAAGAGCTTCTGTCCACAGAGTGGATCGAGGAGATTTTGAAGAAATTTTATAAGCATTGTGATCCTGATTTTGGTGAAGCTTTTCCAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.05

Weight (kDa)

5.53

Isoelectric Point (pI)

56.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 150
AccB7I CCANNNNNTGG 1 cut(s) 120
AclWI GGATC 2 cut(s) 131, 155
AcsI RAATTY 1 cut(s) 143
AdeI CACNNNGTG 1 cut(s) 120
AfaI GTAC 1 cut(s) 13
AfiI CCNNNNNNNGG 2 cut(s) 120, 170
AflIII ACRYGT 1 cut(s) 8
AgsI TTSAA 1 cut(s) 139
AjiI CACGTC 1 cut(s) 9
AluBI AGCT 2 cut(s) 106, 179
AluI AGCT 2 cut(s) 106, 179
AlwI GGATC 2 cut(s) 131, 155
ApoI RAATTY 1 cut(s) 143
Asp700I GAANNNNTTC 2 cut(s) 105, 180
AsuHPI GGTGA 2 cut(s) 16, 185
BfaI CTAG 1 cut(s) 27
BmgBI CACGTC 1 cut(s) 9
Bsc4I CCNNNNNNNGG 2 cut(s) 120, 170
Bse1I ACTGG 1 cut(s) 185
BseLI CCNNNNNNNGG 2 cut(s) 120, 170
BseNI ACTGG 1 cut(s) 185
BseRI GAGGAG 1 cut(s) 143
BslI CCNNNNNNNGG 2 cut(s) 120, 170
Bsp143I GATC 2 cut(s) 123, 160
BspPI GGATC 2 cut(s) 131, 155
BspQI GCTCTTC 1 cut(s) 96
BsrI ACTGG 1 cut(s) 185
BssMI GATC 2 cut(s) 123, 160
Bst6I CTCTTC 1 cut(s) 96
BstKTI GATC 2 cut(s) 126, 163
BstMBI GATC 2 cut(s) 123, 160
BstMWI GCNNNNNNNGC 1 cut(s) 32
BtrI CACGTC 1 cut(s) 9
Csp6I GTAC 1 cut(s) 12
CviJI RGCY 3 cut(s) 59, 106, 179
CviKI_1 RGCY 3 cut(s) 59, 106, 179
CviQI GTAC 1 cut(s) 12
DpnI GATC 2 cut(s) 125, 162
DpnII GATC 2 cut(s) 123, 160
DraIII CACNNNGTG 1 cut(s) 120
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
FaiI YATR 1 cut(s) 150
FspBI CTAG 1 cut(s) 27
HindIII AAGCTT 1 cut(s) 177
HphI GGTGA 2 cut(s) 16, 185
Hpy166II GTNNAC 2 cut(s) 12, 114
Hpy188III TCNNGA 2 cut(s) 96, 164
Hpy8I GTNNAC 2 cut(s) 12, 114
HpyAV CCTTC 1 cut(s) 10
HpyCH4IV ACGT 1 cut(s) 8
HpyCH4V TGCA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpySE526I ACGT 1 cut(s) 8
Kzo9I GATC 2 cut(s) 123, 160
LguI GCTCTTC 1 cut(s) 96
LpnPI CCDG 3 cut(s) 73, 81, 177
MaeI CTAG 1 cut(s) 27
MaeII ACGT 1 cut(s) 8
MaeIII GTNAC 1 cut(s) 4
MalI GATC 2 cut(s) 125, 162
MboI GATC 2 cut(s) 123, 160
MboII GAAGA 2 cut(s) 113, 151
MluCI AATT 1 cut(s) 143
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 2 cut(s) 77, 121
MroXI GAANNNNTTC 2 cut(s) 105, 180
MwoI GCNNNNNNNGC 1 cut(s) 32
NdeII GATC 2 cut(s) 123, 160
NmuCI GTSAC 1 cut(s) 4
PciSI GCTCTTC 1 cut(s) 96
PdmI GAANNNNTTC 2 cut(s) 105, 180
PflMI CCANNNNNTGG 1 cut(s) 120
PsiI TTATAA 1 cut(s) 150
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
SapI GCTCTTC 1 cut(s) 96
Sau3AI GATC 2 cut(s) 123, 160
SetI ASST 4 cut(s) 11, 45, 108, 181
SgeI CNNG 7 cut(s) 21, 39, 56, 72, 108, 139, 176
Sse9I AATT 1 cut(s) 143
SspMI CTAG 1 cut(s) 27
TaiI ACGT 1 cut(s) 11
TaqI TCGA 1 cut(s) 126
TasI AATT 1 cut(s) 143
TseFI GTSAC 1 cut(s) 4
Tsp45I GTSAC 1 cut(s) 4
Van91I CCANNNNNTGG 1 cut(s) 120
XapI RAATTY 1 cut(s) 143
XmnI GAANNNNTTC 2 cut(s) 105, 180
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.