MD17G1126600.v1.1

UDP-Glycosyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0000975
Physical Location & Seq
Reverse (-)
11097163 .. 11097507
345 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1126600.v1.1.491

Sequence Viewer

Length: 345 bp
ATGGATACCACAACAGTAGCTACTAAGCCTCACGCTGTTTGCATTCCAGTTCCGACTCAAAGCCATATCAAGGCAACACTTAAATTTGCAAAACTCCTACACAGTAGAGGTTTTCATATTACCTTTGTCAACACGGAGTTCAATCACAAGTGGTTTCTTAAATCTCTAGGAGCCGATTCCCTAGATGGCTTGCCTGATTTCCGGTTCGAAGCCATCCCAGATGGCATTCCAGATTCAGATGAAGATGCCACCCAAAATCTCACTTTACTCTGCGATTCCATATTAAAACATACTTTCCTGGCGCTGTTTCGTGACCTCCTCACTAAGTTCAACAATGATGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

115

Amino Acids

12.77

Weight (kDa)

6.01

Isoelectric Point (pI)

29.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 70
AgsI TTSAA 2 cut(s) 142, 331
AjnI CCWGG 1 cut(s) 297
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
ApoI RAATTY 1 cut(s) 83
AspLEI GCGC 1 cut(s) 304
AsuII TTCGAA 1 cut(s) 207
BccI CCATC 3 cut(s) 179, 215, 221
BciT130I CCWGG 1 cut(s) 299
BfaI CTAG 2 cut(s) 167, 182
BfoI RGCGCY 1 cut(s) 305
Bme1390I CCNGG 1 cut(s) 299
BmiI GGNNCC 1 cut(s) 172
BmrFI CCNGG 1 cut(s) 299
BmsI GCATC 2 cut(s) 235, 328
Bpu14I TTCGAA 1 cut(s) 207
BsaWI WCCGGW 1 cut(s) 201
Bsc4I CCNNNNNNNGG 1 cut(s) 70
Bse1I ACTGG 1 cut(s) 47
BseBI CCWGG 1 cut(s) 299
BseGI GGATG 1 cut(s) 213
BseLI CCNNNNNNNGG 1 cut(s) 70
BseNI ACTGG 1 cut(s) 47
BseRI GAGGAG 1 cut(s) 308
BsiSI CCGG 1 cut(s) 202
BslI CCNNNNNNNGG 1 cut(s) 70
BsmI GAATGC 2 cut(s) 42, 225
Bsp119I TTCGAA 1 cut(s) 207
BspLI GGNNCC 1 cut(s) 172
BspT104I TTCGAA 1 cut(s) 207
BsrI ACTGG 1 cut(s) 47
Bst2UI CCWGG 1 cut(s) 299
Bst4CI ACNGT 2 cut(s) 16, 104
BstBI TTCGAA 1 cut(s) 207
BstC8I GCNNGC 1 cut(s) 191
BstDEI CTNAG 2 cut(s) 24, 324
BstF5I GGATG 1 cut(s) 213
BstH2I RGCGCY 1 cut(s) 305
BstHHI GCGC 1 cut(s) 304
BstNI CCWGG 1 cut(s) 299
BstSCI CCNGG 1 cut(s) 297
BtsCI GGATG 1 cut(s) 213
Cac8I GCNNGC 1 cut(s) 191
CfoI GCGC 1 cut(s) 304
CviJI RGCY 6 cut(s) 20, 28, 63, 173, 189, 212
CviKI_1 RGCY 6 cut(s) 20, 28, 63, 173, 189, 212
DdeI CTNAG 2 cut(s) 24, 324
EcoRII CCWGG 1 cut(s) 297
FaiI YATR 4 cut(s) 66, 117, 281, 291
FokI GGATG 1 cut(s) 200
FspBI CTAG 2 cut(s) 167, 182
GlaI GCGC 1 cut(s) 303
HaeII RGCGCY 1 cut(s) 305
HapII CCGG 1 cut(s) 202
HhaI GCGC 1 cut(s) 304
Hin6I GCGC 1 cut(s) 302
HinP1I GCGC 1 cut(s) 302
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HinfI GANTC 4 cut(s) 55, 176, 233, 275
HpaII CCGG 1 cut(s) 202
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 2 cut(s) 54, 238
Hpy188III TCNNGA 2 cut(s) 230, 311
Hpy8I GTNNAC 1 cut(s) 130
HpyCH4III ACNGT 2 cut(s) 16, 104
HpyCH4V TGCA 2 cut(s) 42, 89
HpyF3I CTNAG 2 cut(s) 24, 324
HspAI GCGC 1 cut(s) 302
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 7 cut(s) 60, 207, 215, 231, 243, 284, 311
LweI GCATC 2 cut(s) 235, 328
MaeI CTAG 2 cut(s) 167, 182
MaeIII GTNAC 1 cut(s) 311
MboII GAAGA 1 cut(s) 254
MluCI AATT 1 cut(s) 83
MlyI GAGTC 1 cut(s) 49
MmeI TCCRAC 1 cut(s) 77
MnlI CCTC 4 cut(s) 39, 101, 326, 329
MseI TTAA 3 cut(s) 81, 159, 284
MspI CCGG 1 cut(s) 202
MspR9I CCNGG 1 cut(s) 299
Mva1269I GAATGC 2 cut(s) 42, 225
MvaI CCWGG 1 cut(s) 299
NlaIV GGNNCC 1 cut(s) 172
NmuCI GTSAC 1 cut(s) 311
NspV TTCGAA 1 cut(s) 207
PctI GAATGC 2 cut(s) 42, 225
PfeI GAWTC 3 cut(s) 176, 233, 275
PleI GAGTC 1 cut(s) 49
PpsI GAGTC 1 cut(s) 49
Psp6I CCWGG 1 cut(s) 297
PspGI CCWGG 1 cut(s) 297
PspN4I GGNNCC 1 cut(s) 172
SaqAI TTAA 3 cut(s) 81, 159, 284
SchI GAGTC 1 cut(s) 49
ScrFI CCNGG 1 cut(s) 299
SetI ASST 4 cut(s) 22, 112, 125, 318
SfaNI GCATC 2 cut(s) 235, 328
SfuI TTCGAA 1 cut(s) 207
Sse9I AATT 1 cut(s) 83
SspMI CTAG 2 cut(s) 167, 182
StyD4I CCNGG 1 cut(s) 297
TaaI ACNGT 2 cut(s) 16, 104
TaqI TCGA 1 cut(s) 207
TasI AATT 1 cut(s) 83
TfiI GAWTC 3 cut(s) 176, 233, 275
Tru1I TTAA 3 cut(s) 81, 159, 284
Tru9I TTAA 3 cut(s) 81, 159, 284
TseFI GTSAC 1 cut(s) 311
Tsp45I GTSAC 1 cut(s) 311
TspDTI ATGAA 2 cut(s) 104, 255
TspGWI ACGGA 1 cut(s) 149
XapI RAATTY 1 cut(s) 83
XspI CTAG 2 cut(s) 167, 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.