Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp04

Orthogroup ID

OG0000975

Physical Location & Seq

Genomic Coordinates Forward (+)

15452203 .. 15453721

Gene Structure 1519 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.4G237100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 507 bp

ATGCTTAAATTTGCTGTTTGCATTCCATTCCCTGCTCAAAGCCATATAAAGGCAATGCTTAAATTTGCAAAGCTCCTCCACCATAGAGGTTTTCATATAACCTTTGTTAACACACAGTTCAATCACAAGCGCTTTCTTAAAACTCTAGGATCCAATTCCCTCGATGGCTTGCCTGATTTTCAATTTGAAGCCATCCCGGATAGCCTTCCAGATTCAAATGAAGACACCACACAAGATGTCATTAAAAAAATAAAGTTAGACCATTTTCAACAAAGAAATTATGTGGAAGTTTCTTTAAAACCTTGTATAATTATAGAGCTTCCATTGAAGGATTCCTCAAATAAGTTATTTGAGGAACACCCTTGTAGGGTCCACCATTGTATTTCACTAATGAAGAATAAGGCCATGGAGTGGAAAACACAGGCAGAGGAAGCGACCAATCCACACGATTCTTCGTCCACAAACTTAGACAATTTAGCTAATCAAATGCAATCAAGAAAAATCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

169

Amino Acids

19.37

Weight (kDa)

8.34

Isoelectric Point (pI)

34.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000975)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g20571 FvH4_1g20572 FvH4_3g17510
malus_domestica	MD00G1053100.v1.1 MD08G1185400.v1.1 MD09G1142900.v1.1 MD09G1143000.v1.1 MD15G1370900.v1.1 MD17G1125300.v1.1 MD17G1126600.v1.1
prunus_persica	Prupe.3G188800_v2.0.a1 Prupe.4G236900_v2.0.a1 Prupe.4G237100_v2.0.a1 Prupe.4G237200_v2.0.a1 Prupe.6G190200_v2.0.a1
pyrus_communis	pycom01g06040 pycom09g06270 pycom13g19930
rosa_chinensis	RchiOBHm_Chr2g0112951 RchiOBHm_Chr3g0480671 RchiOBHm_Chr5g0029041 RchiOBHm_Chr7g0243721
rosa_laevigata	RLG00000018024 RLG00000020448 RLG00000020751
rosa_multiflora	Rmu_co8020420.1_g000001 Rmu_co8125962.1_g000001 Rmu_co8230237.1_g000001 Rmu_sc0000258.1_g000077 Rmu_sc0000795.1_g000119 Rmu_sc0001021.1_g000012 Rmu_sc0002351.1_g000079 Rmu_sc0002351.1_g000085 Rmu_sc0003444.1_g000014 Rmu_sc0014086.1_g000001 Rmu_sc0031215.1_g000001 Rmu_sc0037859.1_g000001
rosa_roxburghii	Rroxscaffold_1G00050790 Rroxscaffold_1G00050830 Rroxscaffold_2G00094610 Rroxscaffold_2G00097670 Rroxscaffold_2G00130970 Rroxscaffold_2G00131070 Rroxscaffold_3G00221940 Rroxscaffold_3G00248020
rosa_rugosa	Rorug02G0183200 Rorug05G0112400 Rorug05G0112700 Rorug07G0222800 Rorug07G0264200
rosa_samantha	Rh2BG252000 Rh2BG252100 Rh2BG517500 Rh2BG518600 Rh2DG246400 Rh3AG236900 Rh5BG202900 Rh5BG203400 Rh7CG493300 Rh7CG493500 Rh7CG493900
rosa_wichuraiana	Rw2G018670 Rw5G018620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	411
AclWI	GGATC	2 cut(s)	144, 157
AcsI	RAATTY	2 cut(s)	8, 62
AfeI	AGCGCT	1 cut(s)	131
AfiI	CCNNNNNNNGG	3 cut(s)	49, 367, 411
AgsI	TTSAA	6 cut(s)	121, 182, 188, 216, 269, 328
AluBI	AGCT	3 cut(s)	73, 319, 479
AluI	AGCT	3 cut(s)	73, 319, 479
AlwI	GGATC	2 cut(s)	144, 157
Aor51HI	AGCGCT	1 cut(s)	131
AoxI	GGCC	1 cut(s)	402
ApoI	RAATTY	2 cut(s)	8, 62
AspLEI	GCGC	1 cut(s)	132
AspS9I	GGNCC	1 cut(s)	370
AsuC2I	CCSGG	1 cut(s)	197
AvaII	GGWCC	1 cut(s)	370
BamHI	GGATCC	1 cut(s)	149
BbsI	GAAGAC	1 cut(s)	228
BccI	CCATC	2 cut(s)	158, 200
BcnI	CCSGG	1 cut(s)	197
BfaI	CTAG	2 cut(s)	146, 505
BfoI	RGCGCY	1 cut(s)	133
Bme1390I	CCNGG	1 cut(s)	197
Bme18I	GGWCC	1 cut(s)	370
BmgT120I	GGNCC	1 cut(s)	370
BmiI	GGNNCC	2 cut(s)	151, 371
BmrFI	CCNGG	1 cut(s)	197
BpiI	GAAGAC	1 cut(s)	228
BpuMI	CCSGG	1 cut(s)	197
BsaJI	CCNNGG	1 cut(s)	405
Bsc4I	CCNNNNNNNGG	3 cut(s)	49, 367, 411
Bse3DI	GCAATG	1 cut(s)	60
BseDI	CCNNGG	1 cut(s)	405
BseGI	GGATG	1 cut(s)	192
BseLI	CCNNNNNNNGG	3 cut(s)	49, 367, 411
BseMI	GCAATG	1 cut(s)	60
BseRI	GAGGAG	1 cut(s)	65
BshFI	GGCC	1 cut(s)	404
BsiSI	CCGG	1 cut(s)	197
BslI	CCNNNNNNNGG	3 cut(s)	49, 367, 411
BsmI	GAATGC	1 cut(s)	21
BsnI	GGCC	1 cut(s)	404
Bsp143I	GATC	1 cut(s)	149
Bsp19I	CCATGG	1 cut(s)	405
BspANI	GGCC	1 cut(s)	404
BspLI	GGNNCC	2 cut(s)	151, 371
BspPI	GGATC	2 cut(s)	144, 157
BsrDI	GCAATG	1 cut(s)	60
BssECI	CCNNGG	1 cut(s)	405
BssMI	GATC	1 cut(s)	149
BssT1I	CCWWGG	1 cut(s)	405
Bst4CI	ACNGT	1 cut(s)	117
BstC8I	GCNNGC	1 cut(s)	170
BstDEI	CTNAG	1 cut(s)	466
BstDSI	CCRYGG	1 cut(s)	405
BstF5I	GGATG	1 cut(s)	192
BstH2I	RGCGCY	1 cut(s)	133
BstHHI	GCGC	1 cut(s)	132
BstKTI	GATC	1 cut(s)	152
BstMBI	GATC	1 cut(s)	149
BstMWI	GCNNNNNNNGC	1 cut(s)	431
BstSCI	CCNGG	1 cut(s)	195
BstV2I	GAAGAC	1 cut(s)	228
BstX2I	RGATCY	1 cut(s)	149
BstYI	RGATCY	1 cut(s)	149
BsuRI	GGCC	1 cut(s)	404
BtgI	CCRYGG	1 cut(s)	405
BtsCI	GGATG	1 cut(s)	192
Cac8I	GCNNGC	1 cut(s)	170
CfoI	GCGC	1 cut(s)	132
Cfr13I	GGNCC	1 cut(s)	370
CviAII	CATG	1 cut(s)	406
CviJI	RGCY	8 cut(s)	42, 73, 168, 191, 204, 319, 404, 479
CviKI_1	RGCY	8 cut(s)	42, 73, 168, 191, 204, 319, 404, 479
DdeI	CTNAG	1 cut(s)	466
DpnI	GATC	1 cut(s)	151
DpnII	GATC	1 cut(s)	149
DraI	TTTAAA	1 cut(s)	297
Eco130I	CCWWGG	1 cut(s)	405
Eco47I	GGWCC	1 cut(s)	370
Eco47III	AGCGCT	1 cut(s)	131
EcoT14I	CCWWGG	1 cut(s)	405
ErhI	CCWWGG	1 cut(s)	405
FaeI	CATG	1 cut(s)	409
FaiI	YATR	9 cut(s)	45, 47, 84, 96, 98, 282, 308, 314, 407
FatI	CATG	1 cut(s)	405
FokI	GGATG	1 cut(s)	179
FspBI	CTAG	2 cut(s)	146, 505
GlaI	GCGC	1 cut(s)	131
HaeII	RGCGCY	1 cut(s)	133
HaeIII	GGCC	1 cut(s)	404
HapII	CCGG	1 cut(s)	197
HhaI	GCGC	1 cut(s)	132
Hin1II	CATG	1 cut(s)	409
Hin6I	GCGC	1 cut(s)	130
HinP1I	GCGC	1 cut(s)	130
HincII	GTYRAC	1 cut(s)	109
HindII	GTYRAC	1 cut(s)	109
HinfI	GANTC	3 cut(s)	212, 332, 449
HpaI	GTTAAC	1 cut(s)	109
HpaII	CCGG	1 cut(s)	197
Hpy166II	GTNNAC	3 cut(s)	109, 373, 459
Hpy188III	TCNNGA	2 cut(s)	209, 495
Hpy8I	GTNNAC	3 cut(s)	109, 373, 459
HpyAV	CCTTC	2 cut(s)	215, 322
HpyCH4III	ACNGT	1 cut(s)	117
HpyCH4V	TGCA	3 cut(s)	21, 68, 490
HpyF10VI	GCNNNNNNNGC	1 cut(s)	431
HpyF3I	CTNAG	1 cut(s)	466
Hsp92II	CATG	1 cut(s)	409
HspAI	GCGC	1 cut(s)	130
KspAI	GTTAAC	1 cut(s)	109
Kzo9I	GATC	1 cut(s)	149
LmnI	GCTCC	1 cut(s)	78
LpnPI	CCDG	5 cut(s)	45, 186, 210, 222, 407
MaeI	CTAG	2 cut(s)	146, 505
MalI	GATC	1 cut(s)	151
MboI	GATC	1 cut(s)	149
MboII	GAAGA	3 cut(s)	233, 406, 444
MflI	RGATCY	1 cut(s)	149
MluCI	AATT	7 cut(s)	8, 62, 154, 182, 277, 309, 472
MnlI	CCTC	6 cut(s)	80, 86, 170, 346, 346, 421
MseI	TTAA	6 cut(s)	6, 60, 108, 138, 243, 296
MspI	CCGG	1 cut(s)	197
MspR9I	CCNGG	1 cut(s)	197
Mva1269I	GAATGC	1 cut(s)	21
MwoI	GCNNNNNNNGC	1 cut(s)	431
NciI	CCSGG	1 cut(s)	197
NcoI	CCATGG	1 cut(s)	405
NdeII	GATC	1 cut(s)	149
NlaIII	CATG	1 cut(s)	409
NlaIV	GGNNCC	2 cut(s)	151, 371
PctI	GAATGC	1 cut(s)	21
PfeI	GAWTC	3 cut(s)	212, 332, 449
PflMI	CCANNNNNTGG	1 cut(s)	411
PfoI	TCCNGGA	1 cut(s)	195
PspN4I	GGNNCC	2 cut(s)	151, 371
PspPI	GGNCC	1 cut(s)	370
PsuI	RGATCY	1 cut(s)	149
SaqAI	TTAA	6 cut(s)	6, 60, 108, 138, 243, 296
Sau3AI	GATC	1 cut(s)	149
Sau96I	GGNCC	1 cut(s)	370
ScrFI	CCNGG	1 cut(s)	197
SetI	ASST	6 cut(s)	75, 91, 104, 304, 321, 481
SinI	GGWCC	1 cut(s)	370
Sse9I	AATT	7 cut(s)	8, 62, 154, 182, 277, 309, 472
SspMI	CTAG	2 cut(s)	146, 505
StyD4I	CCNGG	1 cut(s)	195
StyI	CCWWGG	1 cut(s)	405
TaaI	ACNGT	1 cut(s)	117
TaqI	TCGA	1 cut(s)	162
TasI	AATT	7 cut(s)	8, 62, 154, 182, 277, 309, 472
TfiI	GAWTC	3 cut(s)	212, 332, 449
Tru1I	TTAA	6 cut(s)	6, 60, 108, 138, 243, 296
Tru9I	TTAA	6 cut(s)	6, 60, 108, 138, 243, 296
TspDTI	ATGAA	3 cut(s)	83, 234, 407
Van91I	CCANNNNNTGG	1 cut(s)	411
VpaK11BI	GGWCC	1 cut(s)	370
XapI	RAATTY	2 cut(s)	8, 62
XspI	CTAG	2 cut(s)	146, 505

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.