Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000795.1

Orthogroup ID

OG0000975

Physical Location & Seq

Genomic Coordinates Reverse (-)

543617 .. 544057

Gene Structure 441 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000795.1_g000119.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

ctgtactccaggggattccacataacctttgtcaactctgagttcaaccatcggcgtttaatccagtccaaagggtctgactccgtcaagggactaccggacttccaattcgcgaccataccggacaggctaccacctgcaaataaagatgcaacccaagatgttccaactctatgcgactccatcaggaaaacatgtctaggccctttcaaggagctggtgactaaactcaattcctcgtctgaagtgccacagattacttgtatagtttctgacgggatcatgggatttgggagggaagttgctaaggaactggggattcctggggttcagctttggacttcttctgcctgtggcttcatggggtacctgcaatacggcgaactcgtcaaacgaggcattgttccattcaaaggtacttcatttctttctgacagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

146

Amino Acids

16.01

Weight (kDa)

8.41

Isoelectric Point (pI)

43.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000975)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g20571 FvH4_1g20572 FvH4_3g17510
malus_domestica	MD00G1053100.v1.1 MD08G1185400.v1.1 MD09G1142900.v1.1 MD09G1143000.v1.1 MD15G1370900.v1.1 MD17G1125300.v1.1 MD17G1126600.v1.1
prunus_persica	Prupe.3G188800_v2.0.a1 Prupe.4G236900_v2.0.a1 Prupe.4G237100_v2.0.a1 Prupe.4G237200_v2.0.a1 Prupe.6G190200_v2.0.a1
pyrus_communis	pycom01g06040 pycom09g06270 pycom13g19930
rosa_chinensis	RchiOBHm_Chr2g0112951 RchiOBHm_Chr3g0480671 RchiOBHm_Chr5g0029041 RchiOBHm_Chr7g0243721
rosa_laevigata	RLG00000018024 RLG00000020448 RLG00000020751
rosa_multiflora	Rmu_co8020420.1_g000001 Rmu_co8125962.1_g000001 Rmu_co8230237.1_g000001 Rmu_sc0000258.1_g000077 Rmu_sc0000795.1_g000119 Rmu_sc0001021.1_g000012 Rmu_sc0002351.1_g000079 Rmu_sc0002351.1_g000085 Rmu_sc0003444.1_g000014 Rmu_sc0014086.1_g000001 Rmu_sc0031215.1_g000001 Rmu_sc0037859.1_g000001
rosa_roxburghii	Rroxscaffold_1G00050790 Rroxscaffold_1G00050830 Rroxscaffold_2G00094610 Rroxscaffold_2G00097670 Rroxscaffold_2G00130970 Rroxscaffold_2G00131070 Rroxscaffold_3G00221940 Rroxscaffold_3G00248020
rosa_rugosa	Rorug02G0183200 Rorug05G0112400 Rorug05G0112700 Rorug07G0222800 Rorug07G0264200
rosa_samantha	Rh2BG252000 Rh2BG252100 Rh2BG517500 Rh2BG518600 Rh2DG246400 Rh3AG236900 Rh5BG202900 Rh5BG203400 Rh7CG493300 Rh7CG493500 Rh7CG493900
rosa_wichuraiana	Rw2G018670 Rw5G018620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	145
Acc36I	ACCTGC	2 cut(s)	145, 378
Acc65I	GGTACC	1 cut(s)	366
AccB1I	GGYRCC	1 cut(s)	366
AccII	CGCG	1 cut(s)	113
AclWI	GGATC	1 cut(s)	287
AcuI	CTGAAG	1 cut(s)	264
AfaI	GTAC	3 cut(s)	5, 368, 418
AfiI	CCNNNNNNNGG	2 cut(s)	211, 413
AflIII	ACRYGT	1 cut(s)	194
AgsI	TTSAA	3 cut(s)	46, 211, 412
AjnI	CCWGG	2 cut(s)	8, 322
AluBI	AGCT	3 cut(s)	217, 334, 438
AluI	AGCT	3 cut(s)	217, 334, 438
AlwI	GGATC	1 cut(s)	287
AoxI	GGCC	1 cut(s)	202
ArsI	GACNNNNNNTTYG	2 cut(s)	92, 124
Asp718I	GGTACC	1 cut(s)	366
AspS9I	GGNCC	1 cut(s)	203
AsuHPI	GGTGA	1 cut(s)	232
BanI	GGYRCC	1 cut(s)	366
BccI	CCATC	2 cut(s)	57, 191
BceAI	ACGGC	1 cut(s)	394
BciT130I	CCWGG	2 cut(s)	10, 324
BfaI	CTAG	1 cut(s)	200
BfuAI	ACCTGC	2 cut(s)	145, 378
Bme1390I	CCNGG	2 cut(s)	10, 324
BmgT120I	GGNCC	1 cut(s)	203
BmiI	GGNNCC	1 cut(s)	368
BmrFI	CCNGG	2 cut(s)	10, 324
BmrI	ACTGGG	1 cut(s)	323
BmsI	GCATC	1 cut(s)	139
BmuI	ACTGGG	1 cut(s)	323
Bpu10I	CCTNAGC	1 cut(s)	306
BsaJI	CCNNGG	2 cut(s)	9, 323
BsaWI	WCCGGW	2 cut(s)	97, 121
Bsc4I	CCNNNNNNNGG	2 cut(s)	211, 413
Bse1I	ACTGG	2 cut(s)	64, 318
BseBI	CCWGG	2 cut(s)	10, 324
BseDI	CCNNGG	2 cut(s)	9, 323
BseLI	CCNNNNNNNGG	2 cut(s)	211, 413
BseMII	CTCAG	1 cut(s)	30
BseNI	ACTGG	2 cut(s)	64, 318
Bsh1236I	CGCG	1 cut(s)	113
BshFI	GGCC	1 cut(s)	204
BshNI	GGYRCC	1 cut(s)	366
BsiSI	CCGG	2 cut(s)	98, 122
BslFI	GGGAC	1 cut(s)	105
BslI	CCNNNNNNNGG	2 cut(s)	211, 413
BsmFI	GGGAC	1 cut(s)	105
BsnI	GGCC	1 cut(s)	204
Bsp143I	GATC	1 cut(s)	279
Bsp68I	TCGCGA	1 cut(s)	113
BspANI	GGCC	1 cut(s)	204
BspCNI	CTCAG	1 cut(s)	31
BspFNI	CGCG	1 cut(s)	113
BspLI	GGNNCC	1 cut(s)	368
BspMI	ACCTGC	2 cut(s)	145, 378
BspPI	GGATC	1 cut(s)	287
BspT107I	GGYRCC	1 cut(s)	366
BsrI	ACTGG	2 cut(s)	64, 318
BssECI	CCNNGG	2 cut(s)	9, 323
BssMI	GATC	1 cut(s)	279
Bst2UI	CCWGG	2 cut(s)	10, 324
BstDEI	CTNAG	2 cut(s)	39, 306
BstFNI	CGCG	1 cut(s)	113
BstKTI	GATC	1 cut(s)	282
BstMBI	GATC	1 cut(s)	279
BstNI	CCWGG	2 cut(s)	10, 324
BstNSI	RCATGY	1 cut(s)	198
BstSCI	CCNGG	2 cut(s)	8, 322
BstUI	CGCG	1 cut(s)	113
BsuRI	GGCC	1 cut(s)	204
BtuMI	TCGCGA	1 cut(s)	113
BveI	ACCTGC	2 cut(s)	145, 378
Cfr13I	GGNCC	1 cut(s)	203
Csp6I	GTAC	3 cut(s)	4, 367, 417
CviAII	CATG	3 cut(s)	195, 283, 361
CviJI	RGCY	6 cut(s)	130, 204, 217, 334, 357, 438
CviKI_1	RGCY	6 cut(s)	130, 204, 217, 334, 357, 438
CviQI	GTAC	3 cut(s)	4, 367, 417
DdeI	CTNAG	2 cut(s)	39, 306
DpnI	GATC	1 cut(s)	281
DpnII	GATC	1 cut(s)	279
Eco57I	CTGAAG	1 cut(s)	264
EcoO109I	RGGNCCY	1 cut(s)	203
EcoRII	CCWGG	2 cut(s)	8, 322
FaeI	CATG	3 cut(s)	198, 286, 364
FaiI	YATR	7 cut(s)	23, 119, 175, 196, 266, 284, 362
FaqI	GGGAC	1 cut(s)	105
FatI	CATG	3 cut(s)	194, 282, 360
FspBI	CTAG	1 cut(s)	200
HaeIII	GGCC	1 cut(s)	204
HapII	CCGG	2 cut(s)	98, 122
Hin1II	CATG	3 cut(s)	198, 286, 364
HincII	GTYRAC	1 cut(s)	34
HindII	GTYRAC	1 cut(s)	34
HinfI	GANTC	4 cut(s)	15, 80, 179, 319
HpaII	CCGG	2 cut(s)	98, 122
HphI	GGTGA	1 cut(s)	232
Hpy166II	GTNNAC	1 cut(s)	34
Hpy188I	TCNGA	5 cut(s)	40, 79, 244, 274, 433
Hpy188III	TCNNGA	2 cut(s)	112, 187
Hpy8I	GTNNAC	1 cut(s)	34
HpyCH4V	TGCA	3 cut(s)	140, 152, 373
HpyF3I	CTNAG	2 cut(s)	39, 306
Hsp92II	CATG	3 cut(s)	198, 286, 364
KpnI	GGTACC	1 cut(s)	370
Kzo9I	GATC	1 cut(s)	279
LmnI	GCTCC	1 cut(s)	214
LweI	GCATC	1 cut(s)	139
MaeI	CTAG	1 cut(s)	200
MaeIII	GTNAC	1 cut(s)	220
MalI	GATC	1 cut(s)	281
MboI	GATC	1 cut(s)	279
MboII	GAAGA	1 cut(s)	336
MluCI	AATT	2 cut(s)	107, 232
MlyI	GAGTC	2 cut(s)	74, 173
MmeI	TCCRAC	1 cut(s)	191
MnlI	CCTC	3 cut(s)	247, 288, 389
MseI	TTAA	1 cut(s)	59
MspA1I	CMGCKG	1 cut(s)	438
MspI	CCGG	2 cut(s)	98, 122
MspR9I	CCNGG	2 cut(s)	10, 324
MvaI	CCWGG	2 cut(s)	10, 324
MvnI	CGCG	1 cut(s)	113
NdeII	GATC	1 cut(s)	279
NlaIII	CATG	3 cut(s)	198, 286, 364
NlaIV	GGNNCC	1 cut(s)	368
NmuCI	GTSAC	1 cut(s)	220
NruI	TCGCGA	1 cut(s)	113
NspI	RCATGY	1 cut(s)	198
PaqCI	CACCTGC	1 cut(s)	145
PciI	ACATGT	1 cut(s)	194
PcsI	WCGNNNNNNNCGW	1 cut(s)	384
PfeI	GAWTC	2 cut(s)	15, 319
PflFI	GACNNNGTC	1 cut(s)	83
PleI	GAGTC	2 cut(s)	74, 173
PpsI	GAGTC	2 cut(s)	74, 173
PscI	ACATGT	1 cut(s)	194
Psp6I	CCWGG	2 cut(s)	8, 322
PspGI	CCWGG	2 cut(s)	8, 322
PspN4I	GGNNCC	1 cut(s)	368
PspPI	GGNCC	1 cut(s)	203
PsyI	GACNNNGTC	1 cut(s)	83
PvuII	CAGCTG	1 cut(s)	438
RruI	TCGCGA	1 cut(s)	113
RsaI	GTAC	3 cut(s)	5, 368, 418
RsaNI	GTAC	3 cut(s)	4, 367, 417
SaqAI	TTAA	1 cut(s)	59
Sau3AI	GATC	1 cut(s)	279
Sau96I	GGNCC	1 cut(s)	203
SchI	GAGTC	2 cut(s)	74, 173
ScrFI	CCNGG	2 cut(s)	10, 324
SetI	ASST	7 cut(s)	29, 139, 219, 336, 372, 418, 440
SfaNI	GCATC	1 cut(s)	139
Sse9I	AATT	2 cut(s)	107, 232
SspMI	CTAG	1 cut(s)	200
StyD4I	CCNGG	2 cut(s)	8, 322
TasI	AATT	2 cut(s)	107, 232
TatI	WGTACW	1 cut(s)	3
TfiI	GAWTC	2 cut(s)	15, 319
Tru1I	TTAA	1 cut(s)	59
Tru9I	TTAA	1 cut(s)	59
TseFI	GTSAC	1 cut(s)	220
Tsp45I	GTSAC	1 cut(s)	220
TspDTI	ATGAA	2 cut(s)	349, 411
TspGWI	ACGGA	1 cut(s)	73
Tth111I	GACNNNGTC	1 cut(s)	83
XceI	RCATGY	1 cut(s)	198
XspI	CTAG	1 cut(s)	200

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.