Prupe.4G236900_v2.0.a1

transferase activity, transferring hexosyl groups

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0000975
Physical Location & Seq
Forward (+)
15437261 .. 15438131
871 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G236900.1

Sequence Viewer

Length: 354 bp
ATGGATTCCACAGAAGTAGCTACTAAGCCACATGCTGTTTGCATTCCATTCCCTGCTCAAAGCCATATAAAGGCAATGCTTAAATTTGCAAAGCTCCTCCACCATAGAGGTTTTCATATAACCTTTGTTAACACACAGTTCAATCACAAGCGCTTTCTTAAAACTCTAGGATCCAATTCCCTCGATGGCTTGCCTGATTTTCAATTTGAAGCCATCCCGGATAGCCTTCCAGATTCAAATGAAGACACCACACAAGATGTCGTTAAAAAAATAAAGTTAGACCATTTTCAACAAAGAAATTATGTGGAAGTTTCTTTAAAACCTTGTATAATTATGTTGGAGATATTGACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

118

Amino Acids

13.37

Weight (kDa)

7.05

Isoelectric Point (pI)

33.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 165, 178
AcsI RAATTY 1 cut(s) 83
AfeI AGCGCT 1 cut(s) 152
AfiI CCNNNNNNNGG 1 cut(s) 70
AgsI TTSAA 5 cut(s) 142, 203, 209, 237, 290
AluBI AGCT 2 cut(s) 20, 94
AluI AGCT 2 cut(s) 20, 94
AlwI GGATC 2 cut(s) 165, 178
Aor51HI AGCGCT 1 cut(s) 152
ApoI RAATTY 1 cut(s) 83
AspLEI GCGC 1 cut(s) 153
AsuC2I CCSGG 1 cut(s) 218
BamHI GGATCC 1 cut(s) 170
BbsI GAAGAC 1 cut(s) 249
BccI CCATC 2 cut(s) 179, 221
BcnI CCSGG 1 cut(s) 218
BfaI CTAG 1 cut(s) 167
BfoI RGCGCY 1 cut(s) 154
Bme1390I CCNGG 1 cut(s) 218
BmiI GGNNCC 1 cut(s) 172
BmrFI CCNGG 1 cut(s) 218
BpiI GAAGAC 1 cut(s) 249
BpuMI CCSGG 1 cut(s) 218
Bsc4I CCNNNNNNNGG 1 cut(s) 70
Bse3DI GCAATG 1 cut(s) 81
BseGI GGATG 1 cut(s) 213
BseLI CCNNNNNNNGG 1 cut(s) 70
BseMI GCAATG 1 cut(s) 81
BseRI GAGGAG 1 cut(s) 86
BsiSI CCGG 1 cut(s) 218
BslI CCNNNNNNNGG 1 cut(s) 70
BsmI GAATGC 1 cut(s) 42
Bsp143I GATC 1 cut(s) 170
BspLI GGNNCC 1 cut(s) 172
BspPI GGATC 2 cut(s) 165, 178
BsrDI GCAATG 1 cut(s) 81
BssMI GATC 1 cut(s) 170
Bst4CI ACNGT 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 191
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 1 cut(s) 213
BstH2I RGCGCY 1 cut(s) 154
BstHHI GCGC 1 cut(s) 153
BstKTI GATC 1 cut(s) 173
BstMBI GATC 1 cut(s) 170
BstNSI RCATGY 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 216
BstV2I GAAGAC 1 cut(s) 249
BstX2I RGATCY 1 cut(s) 170
BstYI RGATCY 1 cut(s) 170
BtsCI GGATG 1 cut(s) 213
Cac8I GCNNGC 1 cut(s) 191
CfoI GCGC 1 cut(s) 153
CviAII CATG 1 cut(s) 32
CviJI RGCY 7 cut(s) 20, 28, 63, 94, 189, 212, 225
CviKI_1 RGCY 7 cut(s) 20, 28, 63, 94, 189, 212, 225
DdeI CTNAG 1 cut(s) 24
DpnI GATC 1 cut(s) 172
DpnII GATC 1 cut(s) 170
DraI TTTAAA 1 cut(s) 318
Eco47III AGCGCT 1 cut(s) 152
FaeI CATG 1 cut(s) 35
FaiI YATR 9 cut(s) 33, 66, 68, 105, 117, 119, 303, 329, 335
FatI CATG 1 cut(s) 31
FokI GGATG 1 cut(s) 200
FspBI CTAG 1 cut(s) 167
GlaI GCGC 1 cut(s) 152
HaeII RGCGCY 1 cut(s) 154
HapII CCGG 1 cut(s) 218
HhaI GCGC 1 cut(s) 153
Hin1II CATG 1 cut(s) 35
Hin6I GCGC 1 cut(s) 151
HinP1I GCGC 1 cut(s) 151
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HinfI GANTC 2 cut(s) 5, 233
HpaI GTTAAC 1 cut(s) 130
HpaII CCGG 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 130
Hpy188III TCNNGA 1 cut(s) 230
Hpy8I GTNNAC 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 236
HpyCH4III ACNGT 1 cut(s) 138
HpyCH4V TGCA 2 cut(s) 42, 89
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 1 cut(s) 35
HspAI GCGC 1 cut(s) 151
KspAI GTTAAC 1 cut(s) 130
Kzo9I GATC 1 cut(s) 170
LmnI GCTCC 1 cut(s) 99
LpnPI CCDG 4 cut(s) 66, 207, 231, 243
MaeI CTAG 1 cut(s) 167
MalI GATC 1 cut(s) 172
MboI GATC 1 cut(s) 170
MboII GAAGA 1 cut(s) 254
MflI RGATCY 1 cut(s) 170
MluCI AATT 5 cut(s) 83, 175, 203, 298, 330
MmeI TCCRAC 1 cut(s) 318
MnlI CCTC 3 cut(s) 101, 107, 191
MseI TTAA 5 cut(s) 81, 129, 159, 264, 317
MspI CCGG 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 218
Mva1269I GAATGC 1 cut(s) 42
NciI CCSGG 1 cut(s) 218
NdeII GATC 1 cut(s) 170
NlaIII CATG 1 cut(s) 35
NlaIV GGNNCC 1 cut(s) 172
NspI RCATGY 1 cut(s) 35
PctI GAATGC 1 cut(s) 42
PfeI GAWTC 2 cut(s) 5, 233
PfoI TCCNGGA 1 cut(s) 216
PspN4I GGNNCC 1 cut(s) 172
PsuI RGATCY 1 cut(s) 170
SaqAI TTAA 5 cut(s) 81, 129, 159, 264, 317
Sau3AI GATC 1 cut(s) 170
ScrFI CCNGG 1 cut(s) 218
SetI ASST 6 cut(s) 22, 96, 112, 125, 325, 353
Sse9I AATT 5 cut(s) 83, 175, 203, 298, 330
SspMI CTAG 1 cut(s) 167
StyD4I CCNGG 1 cut(s) 216
TaaI ACNGT 1 cut(s) 138
TaqI TCGA 1 cut(s) 183
TasI AATT 5 cut(s) 83, 175, 203, 298, 330
TfiI GAWTC 2 cut(s) 5, 233
Tru1I TTAA 5 cut(s) 81, 129, 159, 264, 317
Tru9I TTAA 5 cut(s) 81, 129, 159, 264, 317
TspDTI ATGAA 2 cut(s) 104, 255
XapI RAATTY 1 cut(s) 83
XceI RCATGY 1 cut(s) 35
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.