Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002351.1

Orthogroup ID

OG0000975

Physical Location & Seq

Genomic Coordinates Reverse (-)

295950 .. 296489

Gene Structure 540 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002351.1_g000079.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 540 bp

atgggttcgacacagttaggaaccaaagaactccatgcagtctgtgtccccttcccaacacaaggccatgttaaccccatgatgcaattagccaagcttctgcactccaggggattccgcataacttttgtcaacaccgagttcaaccaccggcgtttaatccgctccagaggttccgactctgtcaagggactaccggacttccaatttgagaccataccggacgggttgccaccttcagataaagatgcaacacaagatatcccggctttatgtgactccactaggaaaacatgtctaggccctttcaaggagctggtgactaagctcaattcctcatctgaagtgccacagattacttgtatagtttctgatggtctcgcgggatttgggagggaagttgctatggaactagggattcctgaggctcagttttggactgcttctgcttgtggcttcatggcgtacctgcaatacagcgaactcgtcaaacgaggcattgtgccatttaaaggtacttcatttctttctgaaacctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0015020 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0050403 GO:0050502 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

179

Amino Acids

19.64

Weight (kDa)

6.89

Isoelectric Point (pI)

35.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000975)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g20571 FvH4_1g20572 FvH4_3g17510
malus_domestica	MD00G1053100.v1.1 MD08G1185400.v1.1 MD09G1142900.v1.1 MD09G1143000.v1.1 MD15G1370900.v1.1 MD17G1125300.v1.1 MD17G1126600.v1.1
prunus_persica	Prupe.3G188800_v2.0.a1 Prupe.4G236900_v2.0.a1 Prupe.4G237100_v2.0.a1 Prupe.4G237200_v2.0.a1 Prupe.6G190200_v2.0.a1
pyrus_communis	pycom01g06040 pycom09g06270 pycom13g19930
rosa_chinensis	RchiOBHm_Chr2g0112951 RchiOBHm_Chr3g0480671 RchiOBHm_Chr5g0029041 RchiOBHm_Chr7g0243721
rosa_laevigata	RLG00000018024 RLG00000020448 RLG00000020751
rosa_multiflora	Rmu_co8020420.1_g000001 Rmu_co8125962.1_g000001 Rmu_co8230237.1_g000001 Rmu_sc0000258.1_g000077 Rmu_sc0000795.1_g000119 Rmu_sc0001021.1_g000012 Rmu_sc0002351.1_g000079 Rmu_sc0002351.1_g000085 Rmu_sc0003444.1_g000014 Rmu_sc0014086.1_g000001 Rmu_sc0031215.1_g000001 Rmu_sc0037859.1_g000001
rosa_roxburghii	Rroxscaffold_1G00050790 Rroxscaffold_1G00050830 Rroxscaffold_2G00094610 Rroxscaffold_2G00097670 Rroxscaffold_2G00130970 Rroxscaffold_2G00131070 Rroxscaffold_3G00221940 Rroxscaffold_3G00248020
rosa_rugosa	Rorug02G0183200 Rorug05G0112400 Rorug05G0112700 Rorug07G0222800 Rorug07G0264200
rosa_samantha	Rh2BG252000 Rh2BG252100 Rh2BG517500 Rh2BG518600 Rh2DG246400 Rh3AG236900 Rh5BG202900 Rh5BG203400 Rh7CG493300 Rh7CG493500 Rh7CG493900
rosa_wichuraiana	Rw2G018670 Rw5G018620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	477
AccBSI	CCGCTC	1 cut(s)	165
AccII	CGCG	1 cut(s)	383
AciI	CCGC	3 cut(s)	118, 163, 383
AcuI	CTGAAG	2 cut(s)	222, 363
AfaI	GTAC	2 cut(s)	467, 517
AfiI	CCNNNNNNNGG	3 cut(s)	62, 310, 512
AflIII	ACRYGT	1 cut(s)	293
AgsI	TTSAA	2 cut(s)	145, 310
AjnI	CCWGG	1 cut(s)	107
AluBI	AGCT	3 cut(s)	97, 316, 328
AluI	AGCT	3 cut(s)	97, 316, 328
Alw26I	GTCTC	2 cut(s)	206, 383
AoxI	GGCC	2 cut(s)	64, 301
ArsI	GACNNNNNNTTYG	2 cut(s)	191, 223
AspS9I	GGNCC	1 cut(s)	302
AsuC2I	CCSGG	1 cut(s)	266
AsuHPI	GGTGA	1 cut(s)	331
AxyI	CCTNAGG	1 cut(s)	423
BccI	CCATC	1 cut(s)	368
BciT130I	CCWGG	1 cut(s)	109
BcnI	CCSGG	1 cut(s)	266
BcoDI	GTCTC	2 cut(s)	206, 383
BfaI	CTAG	3 cut(s)	285, 299, 413
BfuAI	ACCTGC	1 cut(s)	477
Bme1390I	CCNGG	2 cut(s)	109, 266
BmgT120I	GGNCC	1 cut(s)	302
BmiI	GGNNCC	2 cut(s)	22, 175
BmrFI	CCNGG	2 cut(s)	109, 266
BmsI	GCATC	2 cut(s)	72, 238
BpmI	CTGGAG	2 cut(s)	91, 151
BpuMI	CCSGG	1 cut(s)	266
BsaI	GGTCTC	2 cut(s)	206, 383
BsaJI	CCNNGG	1 cut(s)	108
BsaWI	WCCGGW	2 cut(s)	196, 220
Bsc4I	CCNNNNNNNGG	3 cut(s)	62, 310, 512
Bse118I	RCCGGY	1 cut(s)	150
Bse21I	CCTNAGG	1 cut(s)	423
BseBI	CCWGG	1 cut(s)	109
BseDI	CCNNGG	1 cut(s)	108
BseLI	CCNNNNNNNGG	3 cut(s)	62, 310, 512
BseMII	CTCAG	2 cut(s)	414, 443
BsgI	GTGCAG	1 cut(s)	86
Bsh1236I	CGCG	1 cut(s)	383
BshFI	GGCC	2 cut(s)	66, 303
BsiSI	CCGG	4 cut(s)	151, 197, 221, 266
BslFI	GGGAC	2 cut(s)	32, 204
BslI	CCNNNNNNNGG	3 cut(s)	62, 310, 512
BsmAI	GTCTC	2 cut(s)	206, 383
BsmFI	GGGAC	2 cut(s)	32, 204
BsnI	GGCC	2 cut(s)	66, 303
Bso31I	GGTCTC	2 cut(s)	206, 383
BspACI	CCGC	3 cut(s)	118, 163, 383
BspANI	GGCC	2 cut(s)	66, 303
BspCNI	CTCAG	2 cut(s)	415, 442
BspFNI	CGCG	1 cut(s)	383
BspLI	GGNNCC	2 cut(s)	22, 175
BspMI	ACCTGC	1 cut(s)	477
BspTNI	GGTCTC	2 cut(s)	206, 383
BsrBI	CCGCTC	1 cut(s)	165
BsrFI	RCCGGY	1 cut(s)	150
BssAI	RCCGGY	1 cut(s)	150
BssECI	CCNNGG	1 cut(s)	108
Bst2UI	CCWGG	1 cut(s)	109
Bst4CI	ACNGT	1 cut(s)	15
BstDEI	CTNAG	3 cut(s)	324, 423, 429
BstFNI	CGCG	1 cut(s)	383
BstMAI	GTCTC	2 cut(s)	206, 383
BstNI	CCWGG	1 cut(s)	109
BstNSI	RCATGY	1 cut(s)	297
BstSCI	CCNGG	2 cut(s)	107, 264
BstUI	CGCG	1 cut(s)	383
Bsu36I	CCTNAGG	1 cut(s)	423
BsuRI	GGCC	2 cut(s)	66, 303
BveI	ACCTGC	1 cut(s)	477
Cfr10I	RCCGGY	1 cut(s)	150
Cfr13I	GGNCC	1 cut(s)	302
Csp6I	GTAC	2 cut(s)	466, 516
CviAII	CATG	5 cut(s)	35, 68, 79, 294, 460
CviJI	RGCY	9 cut(s)	66, 92, 97, 269, 303, 316, 328, 428, 456
CviKI_1	RGCY	9 cut(s)	66, 92, 97, 269, 303, 316, 328, 428, 456
CviQI	GTAC	2 cut(s)	466, 516
DdeI	CTNAG	3 cut(s)	324, 423, 429
DraI	TTTAAA	1 cut(s)	511
Eco31I	GGTCTC	2 cut(s)	206, 383
Eco32I	GATATC	1 cut(s)	262
Eco57I	CTGAAG	2 cut(s)	222, 363
Eco81I	CCTNAGG	1 cut(s)	423
EcoO109I	RGGNCCY	1 cut(s)	302
EcoRII	CCWGG	1 cut(s)	107
EcoRV	GATATC	1 cut(s)	262
FaeI	CATG	5 cut(s)	38, 71, 82, 297, 463
FaqI	GGGAC	2 cut(s)	32, 204
FatI	CATG	5 cut(s)	34, 67, 78, 293, 459
FauI	CCCGC	1 cut(s)	376
FspBI	CTAG	3 cut(s)	285, 299, 413
GsuI	CTGGAG	2 cut(s)	91, 151
HaeIII	GGCC	2 cut(s)	66, 303
HapII	CCGG	4 cut(s)	151, 197, 221, 266
Hin1II	CATG	5 cut(s)	38, 71, 82, 297, 463
HincII	GTYRAC	2 cut(s)	73, 133
HindII	GTYRAC	2 cut(s)	73, 133
HindIII	AAGCTT	1 cut(s)	95
HinfI	GANTC	4 cut(s)	114, 179, 278, 418
HpaI	GTTAAC	1 cut(s)	73
HpaII	CCGG	4 cut(s)	151, 197, 221, 266
HphI	GGTGA	1 cut(s)	331
Hpy166II	GTNNAC	2 cut(s)	73, 133
Hpy188I	TCNGA	5 cut(s)	178, 241, 343, 373, 532
Hpy188III	TCNNGA	2 cut(s)	168, 422
Hpy8I	GTNNAC	2 cut(s)	73, 133
HpyAV	CCTTC	2 cut(s)	61, 246
HpyCH4III	ACNGT	1 cut(s)	15
HpyCH4V	TGCA	5 cut(s)	38, 85, 103, 251, 472
HpyF3I	CTNAG	3 cut(s)	324, 423, 429
Hsp92II	CATG	5 cut(s)	38, 71, 82, 297, 463
KspAI	GTTAAC	1 cut(s)	73
LmnI	GCTCC	2 cut(s)	170, 313
LweI	GCATC	2 cut(s)	72, 238
MaeI	CTAG	3 cut(s)	285, 299, 413
MaeIII	GTNAC	2 cut(s)	275, 319
MbiI	CCGCTC	1 cut(s)	165
MluCI	AATT	3 cut(s)	86, 206, 331
MlyI	GAGTC	2 cut(s)	173, 272
MmeI	TCCRAC	1 cut(s)	201
MnlI	CCTC	5 cut(s)	164, 346, 387, 418, 488
MseI	TTAA	3 cut(s)	72, 158, 510
MspI	CCGG	4 cut(s)	151, 197, 221, 266
MspR9I	CCNGG	2 cut(s)	109, 266
MvaI	CCWGG	1 cut(s)	109
MvnI	CGCG	1 cut(s)	383
NciI	CCSGG	1 cut(s)	266
NlaIII	CATG	5 cut(s)	38, 71, 82, 297, 463
NlaIV	GGNNCC	2 cut(s)	22, 175
NmuCI	GTSAC	2 cut(s)	275, 319
NspI	RCATGY	1 cut(s)	297
PciI	ACATGT	1 cut(s)	293
PfeI	GAWTC	2 cut(s)	114, 418
PflFI	GACNNNGTC	1 cut(s)	182
PleI	GAGTC	2 cut(s)	173, 272
PpsI	GAGTC	2 cut(s)	173, 272
PscI	ACATGT	1 cut(s)	293
Psp6I	CCWGG	1 cut(s)	107
PspGI	CCWGG	1 cut(s)	107
PspN4I	GGNNCC	2 cut(s)	22, 175
PspPI	GGNCC	1 cut(s)	302
PsyI	GACNNNGTC	1 cut(s)	182
RsaI	GTAC	2 cut(s)	467, 517
RsaNI	GTAC	2 cut(s)	466, 516
SaqAI	TTAA	3 cut(s)	72, 158, 510
Sau96I	GGNCC	1 cut(s)	302
SchI	GAGTC	2 cut(s)	173, 272
ScrFI	CCNGG	2 cut(s)	109, 266
SetI	ASST	8 cut(s)	99, 175, 238, 318, 330, 471, 517, 539
SfaNI	GCATC	2 cut(s)	72, 238
SgrAI	CRCCGGYG	1 cut(s)	150
Sse9I	AATT	3 cut(s)	86, 206, 331
SsiI	CCGC	3 cut(s)	118, 163, 383
SspMI	CTAG	3 cut(s)	285, 299, 413
StyD4I	CCNGG	2 cut(s)	107, 264
TaaI	ACNGT	1 cut(s)	15
TaqI	TCGA	1 cut(s)	8
TasI	AATT	3 cut(s)	86, 206, 331
TfiI	GAWTC	2 cut(s)	114, 418
Tru1I	TTAA	3 cut(s)	72, 158, 510
Tru9I	TTAA	3 cut(s)	72, 158, 510
TseFI	GTSAC	2 cut(s)	275, 319
Tsp45I	GTSAC	2 cut(s)	275, 319
TspDTI	ATGAA	2 cut(s)	448, 510
Tth111I	GACNNNGTC	1 cut(s)	182
XceI	RCATGY	1 cut(s)	297
XspI	CTAG	3 cut(s)	285, 299, 413

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.