Prupe.4G237200_v2.0.a1

transferase activity, transferring hexosyl groups

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0000975
Physical Location & Seq
Forward (+)
15457961 .. 15458335
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G237200.1

Sequence Viewer

Length: 375 bp
ATGGATTCCAAAAAAGTAGCTACTAAGCCACATGCTGTTTGCATTCCAGTTACTGCTCAAAGTCATATAAAACCAATGCTTAAATTTGCAAAGCTCCTCCACCACAGAGGATTTCATATAACCTTTGTTAACACAGAGTTCAATCACAAGCACTTTCTTAAATCTCTAGGACCCAATTCCCTTGATGGCTTGCCTGATTTTCAATTCGAAGCCATCCCGAATAGCCTTCCGGATTCAGATGAAGATGCCACACAAGATGTCACCTTGCTTTGTGAATCCGTCAGAAAACAAAATTTATTGGCTCCCTTTCATGCCATCCTTGCAAAACTCAACAATGATGCCATATCAACATCCAGTAATCCTCCTGTTGTAGAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

125

Amino Acids

13.83

Weight (kDa)

6.7

Isoelectric Point (pI)

35.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 229
AcsI RAATTY 2 cut(s) 83, 292
AgsI TTSAA 2 cut(s) 142, 203
AluBI AGCT 2 cut(s) 20, 94
AluI AGCT 2 cut(s) 20, 94
AlwNI CAGNNNCTG 1 cut(s) 53
Aor13HI TCCGGA 1 cut(s) 229
ApoI RAATTY 2 cut(s) 83, 292
AspS9I GGNCC 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 253
AsuII TTCGAA 1 cut(s) 207
AvaII GGWCC 1 cut(s) 170
BccI CCATC 3 cut(s) 179, 221, 323
BfaI CTAG 1 cut(s) 167
Bme18I GGWCC 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 170
BmiI GGNNCC 2 cut(s) 172, 303
BmsI GCATC 2 cut(s) 235, 328
Bpu14I TTCGAA 1 cut(s) 207
BsaWI WCCGGW 1 cut(s) 229
Bse1I ACTGG 2 cut(s) 47, 354
BseAI TCCGGA 1 cut(s) 229
BseGI GGATG 3 cut(s) 213, 315, 350
BseNI ACTGG 2 cut(s) 47, 354
BseRI GAGGAG 1 cut(s) 86
BsiSI CCGG 1 cut(s) 230
BsmI GAATGC 1 cut(s) 42
Bsp119I TTCGAA 1 cut(s) 207
Bsp13I TCCGGA 1 cut(s) 229
BspEI TCCGGA 1 cut(s) 229
BspLI GGNNCC 2 cut(s) 172, 303
BspT104I TTCGAA 1 cut(s) 207
BsrI ACTGG 2 cut(s) 47, 354
BstBI TTCGAA 1 cut(s) 207
BstC8I GCNNGC 1 cut(s) 191
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 3 cut(s) 213, 315, 350
BstMWI GCNNNNNNNGC 1 cut(s) 320
BstNSI RCATGY 1 cut(s) 35
BtsCI GGATG 3 cut(s) 213, 315, 350
Cac8I GCNNGC 1 cut(s) 191
CaiI CAGNNNCTG 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 170
CviAII CATG 2 cut(s) 32, 311
CviJI RGCY 7 cut(s) 20, 28, 94, 189, 212, 225, 302
CviKI_1 RGCY 7 cut(s) 20, 28, 94, 189, 212, 225, 302
DdeI CTNAG 1 cut(s) 24
Eco47I GGWCC 1 cut(s) 170
EcoO109I RGGNCCY 1 cut(s) 170
FaeI CATG 2 cut(s) 35, 314
FaiI YATR 7 cut(s) 33, 66, 68, 117, 119, 312, 344
FatI CATG 2 cut(s) 31, 310
FokI GGATG 3 cut(s) 200, 302, 337
FspBI CTAG 1 cut(s) 167
HapII CCGG 1 cut(s) 230
Hin1II CATG 2 cut(s) 35, 314
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HinfI GANTC 3 cut(s) 5, 233, 275
HpaI GTTAAC 1 cut(s) 130
HpaII CCGG 1 cut(s) 230
HphI GGTGA 1 cut(s) 253
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 2 cut(s) 238, 284
Hpy188III TCNNGA 2 cut(s) 217, 230
Hpy8I GTNNAC 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 236
HpyCH4V TGCA 3 cut(s) 42, 89, 323
HpyF10VI GCNNNNNNNGC 1 cut(s) 320
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 2 cut(s) 35, 314
Kpn2I TCCGGA 1 cut(s) 229
KspAI GTTAAC 1 cut(s) 130
LmnI GCTCC 2 cut(s) 99, 307
LpnPI CCDG 4 cut(s) 60, 207, 243, 367
LweI GCATC 2 cut(s) 235, 328
MaeI CTAG 1 cut(s) 167
MaeIII GTNAC 2 cut(s) 49, 259
MboII GAAGA 1 cut(s) 254
MluCI AATT 4 cut(s) 83, 175, 203, 292
MnlI CCTC 3 cut(s) 101, 107, 372
MroI TCCGGA 1 cut(s) 229
MseI TTAA 3 cut(s) 81, 129, 159
MspI CCGG 1 cut(s) 230
Mva1269I GAATGC 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 320
NlaIII CATG 2 cut(s) 35, 314
NlaIV GGNNCC 2 cut(s) 172, 303
NmuCI GTSAC 1 cut(s) 259
NspI RCATGY 1 cut(s) 35
NspV TTCGAA 1 cut(s) 207
PctI GAATGC 1 cut(s) 42
PfeI GAWTC 3 cut(s) 5, 233, 275
PpuMI RGGWCCY 1 cut(s) 170
Psp5II RGGWCCY 1 cut(s) 170
PspN4I GGNNCC 2 cut(s) 172, 303
PspPI GGNCC 1 cut(s) 170
PspPPI RGGWCCY 1 cut(s) 170
PstNI CAGNNNCTG 1 cut(s) 53
SaqAI TTAA 3 cut(s) 81, 129, 159
Sau96I GGNCC 1 cut(s) 170
SetI ASST 4 cut(s) 22, 96, 125, 266
SfaNI GCATC 2 cut(s) 235, 328
SfuI TTCGAA 1 cut(s) 207
SinI GGWCC 1 cut(s) 170
Sse9I AATT 4 cut(s) 83, 175, 203, 292
SspMI CTAG 1 cut(s) 167
TaqI TCGA 1 cut(s) 207
TasI AATT 4 cut(s) 83, 175, 203, 292
TfiI GAWTC 3 cut(s) 5, 233, 275
Tru1I TTAA 3 cut(s) 81, 129, 159
Tru9I TTAA 3 cut(s) 81, 129, 159
TseFI GTSAC 1 cut(s) 259
Tsp45I GTSAC 1 cut(s) 259
TspDTI ATGAA 3 cut(s) 104, 255, 299
TspGWI ACGGA 1 cut(s) 268
VpaK11BI GGWCC 1 cut(s) 170
XapI RAATTY 2 cut(s) 83, 292
XceI RCATGY 1 cut(s) 35
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.