RchiOBHm_Chr5g0051771

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001045
Physical Location & Seq
Reverse (-)
53147187 .. 53147976
790 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32922

Sequence Viewer

Length: 216 bp
ATGACGAAGAACCCCATCGCAACTGATTCTCTCCTGAAAGGATTTCATAAGAGAAGGACCTCCCCTAAATGGGTCTCTCAGATGCTCTCTAGAAATGGTTTCAGCTCAAATCCTCAGATAGGCATTCACTCAGTGCTCTGTCTTTTCATGGCGGTCTGTTTGTTCATTCTTCTCTTGTTATATGTTTTTGTTGTTCCATTTGCTCAGTTTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.07

Weight (kDa)

10.2

Isoelectric Point (pI)

55.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 152
AdeI CACNNNGTG 1 cut(s) 133
AfiI CCNNNNNNNGG 3 cut(s) 69, 70, 119
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
Alw21I GWGCWC 1 cut(s) 138
Alw26I GTCTC 1 cut(s) 79
AspS9I GGNCC 1 cut(s) 57
AvaII GGWCC 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 138
BccI CCATC 1 cut(s) 23
BcoDI GTCTC 1 cut(s) 79
BfaI CTAG 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 57
BmgT120I GGNCC 1 cut(s) 57
BmsI GCATC 1 cut(s) 72
BsaI GGTCTC 1 cut(s) 79
Bsc4I CCNNNNNNNGG 3 cut(s) 69, 70, 119
BseLI CCNNNNNNNGG 3 cut(s) 69, 70, 119
BseMII CTCAG 3 cut(s) 92, 128, 144
BsiHKAI GWGCWC 1 cut(s) 138
BslI CCNNNNNNNGG 3 cut(s) 69, 70, 119
BsmAI GTCTC 1 cut(s) 79
BsmI GAATGC 1 cut(s) 123
Bso31I GGTCTC 1 cut(s) 79
Bsp1286I GDGCHC 1 cut(s) 138
BspACI CCGC 1 cut(s) 152
BspCNI CTCAG 3 cut(s) 91, 127, 143
BspTNI GGTCTC 1 cut(s) 79
BstDEI CTNAG 4 cut(s) 78, 114, 130, 204
BstENI CCTNNNNNAGG 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 79
BtsIMutI CAGTG 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 57
CviAII CATG 1 cut(s) 148
CviJI RGCY 1 cut(s) 105
CviKI_1 RGCY 1 cut(s) 105
DdeI CTNAG 4 cut(s) 78, 114, 130, 204
DraIII CACNNNGTG 1 cut(s) 133
Eco31I GGTCTC 1 cut(s) 79
Eco47I GGWCC 1 cut(s) 57
EcoNI CCTNNNNNAGG 1 cut(s) 117
EcoO109I RGGNCCY 1 cut(s) 57
FaeI CATG 1 cut(s) 151
FaiI YATR 4 cut(s) 48, 149, 181, 183
FatI CATG 1 cut(s) 147
FspBI CTAG 1 cut(s) 90
Hin1II CATG 1 cut(s) 151
HinfI GANTC 1 cut(s) 26
Hpy188I TCNGA 2 cut(s) 81, 117
Hpy188III TCNNGA 2 cut(s) 34, 90
HpyAV CCTTC 1 cut(s) 48
HpyF3I CTNAG 4 cut(s) 78, 114, 130, 204
Hsp92II CATG 1 cut(s) 151
LpnPI CCDG 1 cut(s) 47
LweI GCATC 1 cut(s) 72
MaeI CTAG 1 cut(s) 90
MboII GAAGA 2 cut(s) 19, 161
MhlI GDGCHC 1 cut(s) 138
MnlI CCTC 2 cut(s) 70, 123
Mva1269I GAATGC 1 cut(s) 123
NlaIII CATG 1 cut(s) 151
PctI GAATGC 1 cut(s) 123
PfeI GAWTC 1 cut(s) 26
PpuMI RGGWCCY 1 cut(s) 57
Psp5II RGGWCCY 1 cut(s) 57
PspPI GGNCC 1 cut(s) 57
PspPPI RGGWCCY 1 cut(s) 57
Sau96I GGNCC 1 cut(s) 57
SduI GDGCHC 1 cut(s) 138
SetI ASST 2 cut(s) 62, 107
SfaNI GCATC 1 cut(s) 72
SgeI CNNG 4 cut(s) 46, 102, 160, 187
SinI GGWCC 1 cut(s) 57
SsiI CCGC 1 cut(s) 152
SspMI CTAG 1 cut(s) 90
TfiI GAWTC 1 cut(s) 26
TscAI CASTG 1 cut(s) 138
TspDTI ATGAA 3 cut(s) 35, 136, 154
TspRI CASTG 1 cut(s) 138
VpaK11BI GGWCC 1 cut(s) 57
XagI CCTNNNNNAGG 1 cut(s) 117
XbaI TCTAGA 1 cut(s) 89
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.