RchiOBHm_Chr5g0076941

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
82737850 .. 82741626
3777 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35157

Sequence Viewer

Length: 243 bp
ATGCTAAAAGAAAAGTTGAATTTGATGCTATTGAAGAAACTCAAGAAGATATTGAGAGTGTTGAGTCTGGGAGCTCCTCAAACTTCAAGCTCCTTAGACTCCAATGAGGCCATGAGAACAACAAAGCTTGCAAAGCTAGACACTGAAGTAAATTTCTGGATGTATTTTGATAGGAGAGGACTATTAGATGCACTACTTTTGTGGATAAAAGATTATCTTTGTACAATCCATTTTGGTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.27

Weight (kDa)

9.61

Isoelectric Point (pI)

32.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 19, 151
AcuI CTGAAG 1 cut(s) 165
AfaI GTAC 1 cut(s) 223
AgsI TTSAA 3 cut(s) 19, 34, 87
AluBI AGCT 4 cut(s) 74, 90, 127, 136
AluI AGCT 4 cut(s) 74, 90, 127, 136
Alw21I GWGCWC 1 cut(s) 76
AoxI GGCC 1 cut(s) 108
ApoI RAATTY 2 cut(s) 19, 151
BanII GRGCYC 1 cut(s) 76
Bbv12I GWGCWC 1 cut(s) 76
BfaI CTAG 1 cut(s) 137
BmsI GCATC 2 cut(s) 15, 178
BpuEI CTTGAG 1 cut(s) 26
BseGI GGATG 1 cut(s) 165
BseRI GAGGAG 1 cut(s) 66
BshFI GGCC 1 cut(s) 110
BsiHKAI GWGCWC 1 cut(s) 76
BsnI GGCC 1 cut(s) 110
Bsp1286I GDGCHC 1 cut(s) 76
Bsp1407I TGTACA 1 cut(s) 221
BspANI GGCC 1 cut(s) 110
BsrGI TGTACA 1 cut(s) 221
BstAUI TGTACA 1 cut(s) 221
BstC8I GCNNGC 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 94
BstF5I GGATG 1 cut(s) 165
BstMWI GCNNNNNNNGC 1 cut(s) 133
BsuRI GGCC 1 cut(s) 110
BtsCI GGATG 1 cut(s) 165
BtsIMutI CAGTG 1 cut(s) 141
Cac8I GCNNGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 222
CviAII CATG 1 cut(s) 112
CviJI RGCY 5 cut(s) 74, 90, 110, 127, 136
CviKI_1 RGCY 5 cut(s) 74, 90, 110, 127, 136
CviQI GTAC 1 cut(s) 222
DdeI CTNAG 1 cut(s) 94
Ecl136II GAGCTC 1 cut(s) 74
Eco24I GRGCYC 1 cut(s) 76
Eco53kI GAGCTC 1 cut(s) 74
Eco57I CTGAAG 1 cut(s) 165
EcoICRI GAGCTC 1 cut(s) 74
EcoT38I GRGCYC 1 cut(s) 76
FaeI CATG 1 cut(s) 115
FaiI YATR 2 cut(s) 113, 241
FalI AAGNNNNNCTT 2 cut(s) 201, 233
FatI CATG 1 cut(s) 111
FokI GGATG 1 cut(s) 172
FriOI GRGCYC 1 cut(s) 76
FspBI CTAG 1 cut(s) 137
HaeIII GGCC 1 cut(s) 110
Hin1II CATG 1 cut(s) 115
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 2 cut(s) 64, 98
Hpy188III TCNNGA 2 cut(s) 43, 157
HpyCH4V TGCA 3 cut(s) 131, 191, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 133
HpyF3I CTNAG 1 cut(s) 94
Hsp92II CATG 1 cut(s) 115
LmnI GCTCC 3 cut(s) 71, 79, 95
LpnPI CCDG 2 cut(s) 53, 142
LweI GCATC 2 cut(s) 15, 178
MaeI CTAG 1 cut(s) 137
MboII GAAGA 2 cut(s) 46, 58
MhlI GDGCHC 1 cut(s) 76
MluCI AATT 2 cut(s) 19, 151
MlyI GAGTC 2 cut(s) 73, 92
MnlI CCTC 3 cut(s) 87, 100, 170
MslI CAYNNNNRTG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 133
NlaIII CATG 1 cut(s) 115
PleI GAGTC 2 cut(s) 72, 92
PpsI GAGTC 2 cut(s) 72, 92
Psp124BI GAGCTC 1 cut(s) 76
RsaI GTAC 1 cut(s) 223
RsaNI GTAC 1 cut(s) 222
RseI CAYNNNNRTG 1 cut(s) 234
SacI GAGCTC 1 cut(s) 76
SchI GAGTC 2 cut(s) 73, 92
SduI GDGCHC 1 cut(s) 76
SetI ASST 4 cut(s) 76, 92, 129, 138
SfaNI GCATC 2 cut(s) 15, 178
SgeI CNNG 7 cut(s) 55, 80, 99, 124, 140, 149, 169
SmiMI CAYNNNNRTG 1 cut(s) 234
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
Sse9I AATT 2 cut(s) 19, 151
SspMI CTAG 1 cut(s) 137
SstI GAGCTC 1 cut(s) 76
TasI AATT 2 cut(s) 19, 151
TatI WGTACW 1 cut(s) 221
TscAI CASTG 1 cut(s) 148
TspRI CASTG 1 cut(s) 148
XapI RAATTY 2 cut(s) 19, 151
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.