Rh6CG260600

Ubiquitin-2 like Rad60 SUMO-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
43306209 .. 43314206
7998 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG260600.1

Sequence Viewer

Length: 201 bp
ATGGCACTAAGATCTCACAAAGAAGGCCTTGAATCATATCGAGGTACCATTGTGTCTGGCAAGGCAGATTTTACCAAAGAACACAAACCCCTTTTCGATTACAGTCGCGTACAGCCTCTGAATGTCATCTCCCTTGACGACGACGATGGTGGTGAGCTCTTTTCGATAACTGGAATCTTTATGAATTCAATCAAGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.35

Weight (kDa)

5.51

Isoelectric Point (pI)

23.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 44
AccB1I GGYRCC 1 cut(s) 44
AccII CGCG 1 cut(s) 108
AcsI RAATTY 1 cut(s) 184
AfaI GTAC 2 cut(s) 46, 111
AgsI TTSAA 2 cut(s) 32, 189
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
Alw21I GWGCWC 1 cut(s) 159
AlwNI CAGNNNCTG 1 cut(s) 118
AoxI GGCC 1 cut(s) 25
ApoI RAATTY 1 cut(s) 184
Asp718I GGTACC 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 164
BaeI ACNNNNGTAYC 2 cut(s) 36, 69
BanI GGYRCC 1 cut(s) 44
BanII GRGCYC 1 cut(s) 159
Bbv12I GWGCWC 1 cut(s) 159
BccI CCATC 1 cut(s) 140
BglII AGATCT 1 cut(s) 11
BmiI GGNNCC 1 cut(s) 46
Bse1I ACTGG 1 cut(s) 175
BseNI ACTGG 1 cut(s) 175
Bsh1236I CGCG 1 cut(s) 108
BshFI GGCC 1 cut(s) 27
BshNI GGYRCC 1 cut(s) 44
BsiHKAI GWGCWC 1 cut(s) 159
BsnI GGCC 1 cut(s) 27
Bsp1286I GDGCHC 1 cut(s) 159
Bsp143I GATC 1 cut(s) 11
BspANI GGCC 1 cut(s) 27
BspFNI CGCG 1 cut(s) 108
BspLI GGNNCC 1 cut(s) 46
BspT107I GGYRCC 1 cut(s) 44
BsrI ACTGG 1 cut(s) 175
BssMI GATC 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 104
BstDEI CTNAG 1 cut(s) 8
BstFNI CGCG 1 cut(s) 108
BstKTI GATC 1 cut(s) 14
BstMBI GATC 1 cut(s) 11
BstUI CGCG 1 cut(s) 108
BstX2I RGATCY 1 cut(s) 11
BstYI RGATCY 1 cut(s) 11
BsuRI GGCC 1 cut(s) 27
CaiI CAGNNNCTG 1 cut(s) 118
Csp6I GTAC 2 cut(s) 45, 110
CviJI RGCY 4 cut(s) 27, 115, 157, 197
CviKI_1 RGCY 4 cut(s) 27, 115, 157, 197
CviQI GTAC 2 cut(s) 45, 110
DdeI CTNAG 1 cut(s) 8
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
Ecl136II GAGCTC 1 cut(s) 157
Eco147I AGGCCT 1 cut(s) 27
Eco24I GRGCYC 1 cut(s) 159
Eco53kI GAGCTC 1 cut(s) 157
EcoICRI GAGCTC 1 cut(s) 157
EcoRI GAATTC 1 cut(s) 184
EcoT38I GRGCYC 1 cut(s) 159
FaiI YATR 2 cut(s) 37, 182
FalI AAGNNNNNCTT 2 cut(s) 12, 44
FriOI GRGCYC 1 cut(s) 159
HaeIII GGCC 1 cut(s) 27
HinfI GANTC 2 cut(s) 32, 174
HphI GGTGA 1 cut(s) 164
Hpy188I TCNGA 1 cut(s) 120
Hpy99I CGWCG 2 cut(s) 143, 146
HpyAV CCTTC 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 8
KpnI GGTACC 1 cut(s) 48
Kzo9I GATC 1 cut(s) 11
LpnPI CCDG 2 cut(s) 42, 156
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MflI RGATCY 1 cut(s) 11
MhlI GDGCHC 1 cut(s) 159
MluCI AATT 1 cut(s) 184
MnlI CCTC 2 cut(s) 35, 126
MvnI CGCG 1 cut(s) 108
NdeII GATC 1 cut(s) 11
NlaIV GGNNCC 1 cut(s) 46
PceI AGGCCT 1 cut(s) 27
PfeI GAWTC 2 cut(s) 32, 174
Psp124BI GAGCTC 1 cut(s) 159
PspN4I GGNNCC 1 cut(s) 46
PstNI CAGNNNCTG 1 cut(s) 118
PsuI RGATCY 1 cut(s) 11
RsaI GTAC 2 cut(s) 46, 111
RsaNI GTAC 2 cut(s) 45, 110
SacI GAGCTC 1 cut(s) 159
Sau3AI GATC 1 cut(s) 11
SduI GDGCHC 1 cut(s) 159
SetI ASST 2 cut(s) 46, 159
SgeI CNNG 7 cut(s) 41, 53, 69, 73, 119, 146, 183
Sse9I AATT 1 cut(s) 184
SseBI AGGCCT 1 cut(s) 27
SstI GAGCTC 1 cut(s) 159
StuI AGGCCT 1 cut(s) 27
TaaI ACNGT 1 cut(s) 104
TaqI TCGA 3 cut(s) 40, 96, 164
TasI AATT 1 cut(s) 184
TfiI GAWTC 2 cut(s) 32, 174
TspDTI ATGAA 1 cut(s) 197
XapI RAATTY 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.