Rroxscaffold_1G00035950

Pentacotripeptide-repeat region of PRORP

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
52452536 .. 52453316
781 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00035950.1

Sequence Viewer

Length: 336 bp
ATGAGTCTCCCATTTTATTATAGCTATGTTTTCTTCCTCTCCCAGGTCCATGAGATGGTTAGTGCTGGAGTAGAACCAAATGTTCACACATATGAGGCACGATTGATGGTTGTGGCGAGCTGGCATGGAGAAGTGGCAAAGGCATTTGGTGCTTATGGGATAATGAGGTCTAAGTTTGAGCAAAAGGCAAATGAGGTGGTGATCGAGCTTCCTTGGGTCAAGAATGTCATTGTGACTATGTCAAGCACAACCTGCACAACCCCTTTATGCCAGGCAACTTCCACAAGAGTTTACAGACAATTTCAAATATTGTGGCAGTTTCTAGTTGCAAGGTAG

Protein Analysis

111

Amino Acids

12.75

Weight (kDa)

8.64

Isoelectric Point (pI)

38.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 260
AccB7I CCANNNNNTGG 1 cut(s) 55
AfiI CCNNNNNNNGG 2 cut(s) 43, 55
AgsI TTSAA 1 cut(s) 305
AjnI CCWGG 2 cut(s) 42, 270
AluBI AGCT 3 cut(s) 24, 120, 208
AluI AGCT 3 cut(s) 24, 120, 208
Alw26I GTCTC 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 211
AvaII GGWCC 1 cut(s) 46
BccI CCATC 2 cut(s) 49, 100
BciT130I CCWGG 2 cut(s) 44, 272
BcoDI GTCTC 1 cut(s) 11
BfaI CTAG 1 cut(s) 323
BfuAI ACCTGC 1 cut(s) 260
Bme1390I CCNGG 2 cut(s) 44, 272
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BmrFI CCNGG 2 cut(s) 44, 272
BpmI CTGGAG 1 cut(s) 87
BsaJI CCNNGG 2 cut(s) 42, 212
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 55
BseBI CCWGG 2 cut(s) 44, 272
BseDI CCNNGG 2 cut(s) 42, 212
BseLI CCNNNNNNNGG 2 cut(s) 43, 55
BsgI GTGCAG 1 cut(s) 238
BslI CCNNNNNNNGG 2 cut(s) 43, 55
BsmAI GTCTC 1 cut(s) 11
Bsp143I GATC 1 cut(s) 201
BspMI ACCTGC 1 cut(s) 260
BssECI CCNNGG 2 cut(s) 42, 212
BssMI GATC 1 cut(s) 201
BssT1I CCWWGG 1 cut(s) 212
Bst2UI CCWGG 2 cut(s) 44, 272
BstAPI GCANNNNNTGC 2 cut(s) 149, 252
BstC8I GCNNGC 2 cut(s) 118, 122
BstDEI CTNAG 1 cut(s) 171
BstENI CCTNNNNNAGG 1 cut(s) 41
BstKTI GATC 1 cut(s) 204
BstMAI GTCTC 1 cut(s) 11
BstMBI GATC 1 cut(s) 201
BstMWI GCNNNNNNNGC 2 cut(s) 149, 252
BstNI CCWGG 2 cut(s) 44, 272
BstSCI CCNGG 2 cut(s) 42, 270
BveI ACCTGC 1 cut(s) 260
Cac8I GCNNGC 2 cut(s) 118, 122
Cfr13I GGNCC 1 cut(s) 46
CspCI CAANNNNNGTGG 4 cut(s) 177, 212, 293, 328
CviAII CATG 2 cut(s) 50, 125
CviJI RGCY 3 cut(s) 24, 120, 208
CviKI_1 RGCY 3 cut(s) 24, 120, 208
DdeI CTNAG 1 cut(s) 171
DpnI GATC 1 cut(s) 203
DpnII GATC 1 cut(s) 201
Eco130I CCWWGG 1 cut(s) 212
Eco47I GGWCC 1 cut(s) 46
EcoNI CCTNNNNNAGG 1 cut(s) 41
EcoRII CCWGG 2 cut(s) 42, 270
EcoT14I CCWWGG 1 cut(s) 212
ErhI CCWWGG 1 cut(s) 212
FaeI CATG 2 cut(s) 53, 128
FaiI YATR 9 cut(s) 21, 27, 51, 91, 93, 126, 156, 239, 268
FatI CATG 2 cut(s) 49, 124
FauNDI CATATG 1 cut(s) 91
FspBI CTAG 1 cut(s) 323
GsuI CTGGAG 1 cut(s) 87
Hin1II CATG 2 cut(s) 53, 128
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 211
Hpy166II GTNNAC 2 cut(s) 85, 292
Hpy188III TCNNGA 1 cut(s) 220
Hpy8I GTNNAC 2 cut(s) 85, 292
HpyCH4V TGCA 2 cut(s) 255, 329
HpyF10VI GCNNNNNNNGC 2 cut(s) 149, 252
HpyF3I CTNAG 1 cut(s) 171
Hsp92II CATG 2 cut(s) 53, 128
Kzo9I GATC 1 cut(s) 201
LpnPI CCDG 7 cut(s) 29, 51, 56, 106, 257, 265, 284
MaeI CTAG 1 cut(s) 323
MaeIII GTNAC 1 cut(s) 232
MalI GATC 1 cut(s) 203
MboI GATC 1 cut(s) 201
MboII GAAGA 1 cut(s) 25
MluCI AATT 1 cut(s) 299
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 4 cut(s) 47, 88, 159, 187
MslI CAYNNNNRTG 1 cut(s) 90
MspR9I CCNGG 2 cut(s) 44, 272
MvaI CCWGG 2 cut(s) 44, 272
MwoI GCNNNNNNNGC 2 cut(s) 149, 252
NdeI CATATG 1 cut(s) 91
NdeII GATC 1 cut(s) 201
NlaIII CATG 2 cut(s) 53, 128
NmuCI GTSAC 1 cut(s) 232
PflFI GACNNNGTC 1 cut(s) 238
PflMI CCANNNNNTGG 1 cut(s) 55
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
Psp6I CCWGG 2 cut(s) 42, 270
PspGI CCWGG 2 cut(s) 42, 270
PspPI GGNCC 1 cut(s) 46
PsyI GACNNNGTC 1 cut(s) 238
RseI CAYNNNNRTG 1 cut(s) 90
Sau3AI GATC 1 cut(s) 201
Sau96I GGNCC 1 cut(s) 46
SchI GAGTC 1 cut(s) 13
ScrFI CCNGG 2 cut(s) 44, 272
SetI ASST 8 cut(s) 26, 48, 122, 170, 198, 210, 254, 335
SinI GGWCC 1 cut(s) 46
SmiMI CAYNNNNRTG 1 cut(s) 90
Sse9I AATT 1 cut(s) 299
SspI AATATT 1 cut(s) 309
SspMI CTAG 1 cut(s) 323
StyD4I CCNGG 2 cut(s) 42, 270
StyI CCWWGG 1 cut(s) 212
TaqI TCGA 1 cut(s) 204
TasI AATT 1 cut(s) 299
TseFI GTSAC 1 cut(s) 232
Tsp45I GTSAC 1 cut(s) 232
Tth111I GACNNNGTC 1 cut(s) 238
Van91I CCANNNNNTGG 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 46
XagI CCTNNNNNAGG 1 cut(s) 41
XspI CTAG 1 cut(s) 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.