Rmu_sc0004502.1_g000020

anion transporter 3

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004502.1
Physical Location & Seq
Forward (+)
82584 .. 85342
2759 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004502.1_g000020.1.cds

Sequence Viewer

Length: 402 bp
atggcatggggtgtggccatgtggtctttggccactctcctcactccctgggctaccaaccattctacaaccagcctattggctgttcatgccttctttggattcgttaaaggtgtggccctgccttccatgagcaccctcttatcaagtgctggagtagaaccaaatgttcacacatatggggcactgattgatggttgtggcagagctggggaagtggcaaaggcatttggtgcttatgggataatgaggtctaaggcgtgccagcactgtggggtgcagtcgtcgggggagttccttgacctgacttcttcttcaagcgatgtggacgaggagagcatcaacctcgtcacagggctcttttcttgccttccgagaaaggacttcttgccttattggtaa

Protein Analysis

133

Amino Acids

14.12

Weight (kDa)

5.69

Isoelectric Point (pI)

31.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 15, 30
AgsI TTSAA 1 cut(s) 318
AjnI CCWGG 1 cut(s) 47
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
Alw21I GWGCWC 1 cut(s) 137
AoxI GGCC 3 cut(s) 15, 30, 117
AspS9I GGNCC 1 cut(s) 118
BaeGI GKGCMC 1 cut(s) 187
BalI TGGCCA 2 cut(s) 17, 32
BanII GRGCYC 1 cut(s) 360
Bbv12I GWGCWC 1 cut(s) 137
BccI CCATC 1 cut(s) 188
BcgI CGANNNNNNTGC 2 cut(s) 328, 362
BciT130I CCWGG 1 cut(s) 49
Bme1390I CCNGG 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 118
BmrFI CCNGG 1 cut(s) 49
BmsI GCATC 1 cut(s) 348
BpmI CTGGAG 1 cut(s) 174
BsaJI CCNNGG 2 cut(s) 47, 48
BseBI CCWGG 1 cut(s) 49
BseDI CCNNGG 2 cut(s) 47, 48
BseRI GAGGAG 2 cut(s) 29, 347
BseSI GKGCMC 1 cut(s) 187
BseYI CCCAGC 1 cut(s) 209
BsgI GTGCAG 1 cut(s) 299
BshFI GGCC 3 cut(s) 17, 32, 119
BsiHKAI GWGCWC 1 cut(s) 137
BsnI GGCC 3 cut(s) 17, 32, 119
Bsp1286I GDGCHC 3 cut(s) 137, 187, 360
BspANI GGCC 3 cut(s) 17, 32, 119
BssECI CCNNGG 2 cut(s) 47, 48
Bst2UI CCWGG 1 cut(s) 49
Bst4CI ACNGT 1 cut(s) 272
BstAPI GCANNNNNTGC 1 cut(s) 233
BstC8I GCNNGC 2 cut(s) 262, 266
BstDEI CTNAG 1 cut(s) 255
BstMWI GCNNNNNNNGC 2 cut(s) 89, 233
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 1 cut(s) 47
BstSLI GKGCMC 1 cut(s) 187
BstXI CCANNNNNNTGG 2 cut(s) 79, 272
BsuRI GGCC 3 cut(s) 17, 32, 119
BtgZI GCGATG 1 cut(s) 336
BtsIMutI CAGTG 2 cut(s) 185, 268
Cac8I GCNNGC 2 cut(s) 262, 266
Cfr13I GGNCC 1 cut(s) 118
CspCI CAANNNNNGTGG 2 cut(s) 306, 341
CviAII CATG 4 cut(s) 6, 19, 89, 130
CviJI RGCY 8 cut(s) 17, 32, 53, 75, 83, 119, 209, 358
CviKI_1 RGCY 8 cut(s) 17, 32, 53, 75, 83, 119, 209, 358
DdeI CTNAG 1 cut(s) 255
EaeI YGGCCR 2 cut(s) 15, 30
Eco24I GRGCYC 1 cut(s) 360
EcoRII CCWGG 1 cut(s) 47
EcoT38I GRGCYC 1 cut(s) 360
FaeI CATG 4 cut(s) 9, 22, 92, 133
FaiI YATR 7 cut(s) 7, 20, 90, 131, 178, 180, 240
FalI AAGNNNNNCTT 1 cut(s) 371
FatI CATG 4 cut(s) 5, 18, 88, 129
FauNDI CATATG 1 cut(s) 178
FriOI GRGCYC 1 cut(s) 360
GsaI CCCAGC 1 cut(s) 213
GsuI CTGGAG 1 cut(s) 174
HaeIII GGCC 3 cut(s) 17, 32, 119
Hin1II CATG 4 cut(s) 9, 22, 92, 133
HinfI GANTC 1 cut(s) 102
Hpy166II GTNNAC 2 cut(s) 172, 328
Hpy188I TCNGA 1 cut(s) 375
Hpy8I GTNNAC 2 cut(s) 172, 328
Hpy99I CGWCG 1 cut(s) 289
HpyAV CCTTC 3 cut(s) 103, 135, 380
HpyCH4III ACNGT 1 cut(s) 272
HpyCH4V TGCA 1 cut(s) 280
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 233
HpyF3I CTNAG 1 cut(s) 255
Hsp92II CATG 4 cut(s) 9, 22, 92, 133
LpnPI CCDG 9 cut(s) 34, 61, 85, 134, 138, 195, 278, 317, 339
LweI GCATC 1 cut(s) 348
MaeIII GTNAC 1 cut(s) 349
MboII GAAGA 2 cut(s) 303, 306
MhlI GDGCHC 3 cut(s) 137, 187, 360
MlsI TGGCCA 2 cut(s) 17, 32
MluNI TGGCCA 2 cut(s) 17, 32
MnlI CCTC 5 cut(s) 50, 149, 243, 325, 356
Mox20I TGGCCA 2 cut(s) 17, 32
MscI TGGCCA 2 cut(s) 17, 32
MseI TTAA 1 cut(s) 108
MslI CAYNNNNRTG 1 cut(s) 177
Msp20I TGGCCA 2 cut(s) 17, 32
MspR9I CCNGG 1 cut(s) 49
MvaI CCWGG 1 cut(s) 49
MwoI GCNNNNNNNGC 2 cut(s) 89, 233
NdeI CATATG 1 cut(s) 178
NlaIII CATG 4 cut(s) 9, 22, 92, 133
NmuCI GTSAC 1 cut(s) 349
PasI CCCWGGG 1 cut(s) 48
PfeI GAWTC 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 47
PspFI CCCAGC 1 cut(s) 209
PspGI CCWGG 1 cut(s) 47
PspPI GGNCC 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 177
SaqAI TTAA 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 118
ScrFI CCNGG 1 cut(s) 49
SduI GDGCHC 3 cut(s) 137, 187, 360
SetI ASST 5 cut(s) 115, 211, 254, 306, 348
SfaNI GCATC 1 cut(s) 348
SmiMI CAYNNNNRTG 1 cut(s) 177
StyD4I CCNGG 1 cut(s) 47
TaaI ACNGT 1 cut(s) 272
TfiI GAWTC 1 cut(s) 102
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TscAI CASTG 2 cut(s) 192, 275
TseFI GTSAC 1 cut(s) 349
Tsp45I GTSAC 1 cut(s) 349
TspDTI ATGAA 1 cut(s) 77
TspRI CASTG 2 cut(s) 192, 275
XcmI CCANNNNNNNNNTGG 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.