Rh4AG386800

Microtubule-associated protein RP EB family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
69325776 .. 69361606
35831 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG386800.1

Sequence Viewer

Length: 264 bp
ATGGCGACGAATATCGGCATGATGGACGGTGCTTACTTCGTCAGTAGATCTGAGATCTTGGCTTGGATCAACTCCACTCGATCTCCAACTCCATCTAAACAAAGTCAAAGAGAGAACAATGTTCGTCGTCGTCGGAAGAACCGATTGGTTTGGGTCTTTTCTGGGACCAATGATTGTATATATGTGTATCCATTATTCTACGGGATAACGGGAAGCATATATGTTTCTAGGTTAAAATGTGACGTGGTATGGTTTAACCAATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

10.16

Weight (kDa)

10.02

Isoelectric Point (pI)

69.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 74
AjiI CACGTC 1 cut(s) 244
AjuI GAANNNNNNNTTGG 2 cut(s) 128, 160
AlwI GGATC 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 165
AvaII GGWCC 1 cut(s) 165
BccI CCATC 2 cut(s) 16, 100
BciVI GTATCC 1 cut(s) 198
BfaI CTAG 1 cut(s) 228
BfuI GTATCC 1 cut(s) 198
BglII AGATCT 2 cut(s) 47, 54
Bme18I GGWCC 1 cut(s) 165
BmgBI CACGTC 1 cut(s) 244
BmgT120I GGNCC 1 cut(s) 165
BmiI GGNNCC 1 cut(s) 166
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
BseMII CTCAG 1 cut(s) 42
BslFI GGGAC 1 cut(s) 178
BsmFI GGGAC 1 cut(s) 178
Bsp143I GATC 4 cut(s) 47, 54, 66, 80
BspCNI CTCAG 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 166
BspPI GGATC 1 cut(s) 74
BssMI GATC 4 cut(s) 47, 54, 66, 80
Bst4CI ACNGT 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 51
BstKTI GATC 4 cut(s) 50, 57, 69, 83
BstMBI GATC 4 cut(s) 47, 54, 66, 80
BstX2I RGATCY 2 cut(s) 47, 54
BstYI RGATCY 2 cut(s) 47, 54
BsuI GTATCC 1 cut(s) 198
BtrI CACGTC 1 cut(s) 244
Cfr13I GGNCC 1 cut(s) 165
CviAII CATG 1 cut(s) 19
CviJI RGCY 1 cut(s) 62
CviKI_1 RGCY 1 cut(s) 62
DdeI CTNAG 1 cut(s) 51
DpnI GATC 4 cut(s) 49, 56, 68, 82
DpnII GATC 4 cut(s) 47, 54, 66, 80
Eco47I GGWCC 1 cut(s) 165
FaeI CATG 1 cut(s) 22
FaiI YATR 8 cut(s) 20, 179, 181, 183, 218, 220, 222, 250
FaqI GGGAC 1 cut(s) 178
FatI CATG 1 cut(s) 18
FspBI CTAG 1 cut(s) 228
Hin1II CATG 1 cut(s) 22
Hpy188I TCNGA 2 cut(s) 52, 135
Hpy99I CGWCG 4 cut(s) 10, 129, 132, 135
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4IV ACGT 1 cut(s) 243
HpyF3I CTNAG 1 cut(s) 51
HpySE526I ACGT 1 cut(s) 243
Hsp92II CATG 1 cut(s) 22
Kzo9I GATC 4 cut(s) 47, 54, 66, 80
LpnPI CCDG 1 cut(s) 147
MaeI CTAG 1 cut(s) 228
MaeII ACGT 1 cut(s) 243
MaeIII GTNAC 1 cut(s) 239
MalI GATC 4 cut(s) 49, 56, 68, 82
MboI GATC 4 cut(s) 47, 54, 66, 80
MboII GAAGA 1 cut(s) 148
MflI RGATCY 2 cut(s) 47, 54
MmeI TCCRAC 2 cut(s) 110, 113
MseI TTAA 2 cut(s) 233, 255
NdeII GATC 4 cut(s) 47, 54, 66, 80
NlaIII CATG 1 cut(s) 22
NlaIV GGNNCC 1 cut(s) 166
NmuCI GTSAC 1 cut(s) 239
PcsI WCGNNNNNNNCGW 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 166
PspPI GGNCC 1 cut(s) 165
PsuI RGATCY 2 cut(s) 47, 54
SaqAI TTAA 2 cut(s) 233, 255
Sau3AI GATC 4 cut(s) 47, 54, 66, 80
Sau96I GGNCC 1 cut(s) 165
SetI ASST 2 cut(s) 233, 246
SgeI CNNG 9 cut(s) 31, 70, 75, 90, 174, 214, 222, 240, 256
SinI GGWCC 1 cut(s) 165
SspMI CTAG 1 cut(s) 228
TaaI ACNGT 1 cut(s) 29
TaiI ACGT 1 cut(s) 246
TaqI TCGA 1 cut(s) 79
Tru1I TTAA 2 cut(s) 233, 255
Tru9I TTAA 2 cut(s) 233, 255
TseFI GTSAC 1 cut(s) 239
Tsp45I GTSAC 1 cut(s) 239
VpaK11BI GGWCC 1 cut(s) 165
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.