Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001192.1

Orthogroup ID

OG0001045

Physical Location & Seq

Genomic Coordinates Forward (+)

200213 .. 203049

Gene Structure 2837 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001192.1_g000043.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 483 bp

atgtggaaagttttggagcatgctagtggcctcagctttgaagagctttactggttattcaatctccgcccactacccactggcatgacgatatcaaatgacgagagcttggctcaattcctcgaaacggaggtggtctccgaccaggtggacaacataaattcatcaacagccaagcgtgctagaaccaacgagaaattaataaccagtcttgagcccatgagagtgagactttatggagttgatgaacccaatgtgagttctgcaatcaaagatatttcatgggataatcttgctggatatgatctacaaaagcagctttggatagctttggataaatcgaagtatatggatgaccttcgagcagtaagaaagcacattcagaagctggaacaggaccttgagttgtttaaagcacatgctaaaagaaaagttgaatttagttatgatgctattgaagaaactccagaagatagagtgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03018 map03018

Pfam Domains

Protein Families

CRS1_YhbY EF-hand_1 EF-hand_5

Protein Analysis

160

Amino Acids

18.58

Weight (kDa)

5.04

Isoelectric Point (pI)

41.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001045)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g04540
rosa_chinensis	RchiOBHm_Chr1g0338921 RchiOBHm_Chr1g0342131 RchiOBHm_Chr2g0159881 RchiOBHm_Chr5g0002061 RchiOBHm_Chr5g0051771 RchiOBHm_Chr5g0076941 RchiOBHm_Chr6g0282081 RchiOBHm_Chr7g0198131
rosa_laevigata	RLG00000003496 RLG00000019204 RLG00000019210 RLG00000031093 RLG00000034339 RLG00000035955
rosa_multiflora	Rmu_co8265413.1_g000001 Rmu_sc0000569.1_g000024 Rmu_sc0000585.1_g000006 Rmu_sc0000780.1_g000015 Rmu_sc0001192.1_g000043 Rmu_sc0001700.1_g000048 Rmu_sc0003092.1_g000032 Rmu_sc0004502.1_g000020 Rmu_sc0004991.1_g000005 Rmu_sc0041726.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033570 Rroxscaffold_1G00035950 Rroxscaffold_1G00047770 Rroxscaffold_2G00124770 Rroxscaffold_2G00143760 Rroxscaffold_3G00227140 Rroxscaffold_5G00341620
rosa_rugosa	Rorug01G0102800 Rorug02G0472100 Rorug03G0011600 Rorug04G0024700 Rorug05G0042700
rosa_samantha	Rh1AG421900 Rh2AG356700 Rh2BG577700 Rh2CG210300 Rh2DG229300 Rh2DG624300 Rh3CG229200 Rh4AG386800 Rh4CG238600 Rh4DG226600 Rh4DG393700 Rh5AG380700 Rh5BG360500 Rh5DG260600 Rh6AG053500 Rh6AG258300 Rh6BG316700 Rh6CG120500 Rh6CG260600 Rh6DG252700 Rh6DG497500 Rh7AG364300 Rh7CG383100
rosa_wichuraiana	Rw6G022360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	67
AcsI	RAATTY	2 cut(s)	160, 437
AfiI	CCNNNNNNNGG	1 cut(s)	127
AgsI	TTSAA	4 cut(s)	41, 61, 437, 458
AjnI	CCWGG	1 cut(s)	144
AluBI	AGCT	6 cut(s)	36, 46, 108, 319, 329, 388
AluI	AGCT	6 cut(s)	36, 46, 108, 319, 329, 388
Alw26I	GTCTC	2 cut(s)	142, 223
AlwNI	CAGNNNCTG	1 cut(s)	388
AoxI	GGCC	1 cut(s)	28
ApeKI	GCWGC	1 cut(s)	316
ApoI	RAATTY	2 cut(s)	160, 437
AseI	ATTAAT	1 cut(s)	200
AspS9I	GGNCC	1 cut(s)	397
AvaII	GGWCC	1 cut(s)	397
BanII	GRGCYC	1 cut(s)	219
BbvCI	CCTCAGC	1 cut(s)	32
BbvI	GCAGC	1 cut(s)	328
BciT130I	CCWGG	1 cut(s)	146
BcoDI	GTCTC	2 cut(s)	142, 223
BfaI	CTAG	2 cut(s)	24, 183
BisI	GCNGC	1 cut(s)	317
BlsI	GCNGC	1 cut(s)	318
Bme1390I	CCNGG	1 cut(s)	146
Bme18I	GGWCC	1 cut(s)	397
BmgT120I	GGNCC	1 cut(s)	397
BmrFI	CCNGG	1 cut(s)	146
BmsI	GCATC	1 cut(s)	439
BplI	GAGNNNNNCTC	4 cut(s)	97, 129, 122, 154
BpmI	CTGGAG	1 cut(s)	450
Bpu10I	CCTNAGC	1 cut(s)	32
BpuEI	CTTGAG	2 cut(s)	233, 422
BsaI	GGTCTC	1 cut(s)	142
Bsc4I	CCNNNNNNNGG	1 cut(s)	127
Bse1I	ACTGG	3 cut(s)	56, 85, 207
BseBI	CCWGG	1 cut(s)	146
BseGI	GGATG	1 cut(s)	358
BseLI	CCNNNNNNNGG	1 cut(s)	127
BseMII	CTCAG	1 cut(s)	46
BseNI	ACTGG	3 cut(s)	56, 85, 207
BseXI	GCAGC	1 cut(s)	328
BshFI	GGCC	1 cut(s)	30
BslI	CCNNNNNNNGG	1 cut(s)	127
BsmAI	GTCTC	2 cut(s)	142, 223
BsnI	GGCC	1 cut(s)	30
Bso31I	GGTCTC	1 cut(s)	142
Bsp1286I	GDGCHC	1 cut(s)	219
Bsp143I	GATC	1 cut(s)	304
BspACI	CCGC	1 cut(s)	67
BspANI	GGCC	1 cut(s)	30
BspCNI	CTCAG	1 cut(s)	45
BspQI	GCTCTTC	1 cut(s)	36
BspTNI	GGTCTC	1 cut(s)	142
BsrI	ACTGG	3 cut(s)	56, 85, 207
BssMI	GATC	1 cut(s)	304
Bst2UI	CCWGG	1 cut(s)	146
Bst6I	CTCTTC	1 cut(s)	36
BstC8I	GCNNGC	2 cut(s)	21, 180
BstDEI	CTNAG	1 cut(s)	32
BstF5I	GGATG	1 cut(s)	358
BstKTI	GATC	1 cut(s)	307
BstMAI	GTCTC	2 cut(s)	142, 223
BstMBI	GATC	1 cut(s)	304
BstMWI	GCNNNNNNNGC	1 cut(s)	179
BstNI	CCWGG	1 cut(s)	146
BstNSI	RCATGY	2 cut(s)	23, 422
BstSCI	CCNGG	1 cut(s)	144
BstV1I	GCAGC	1 cut(s)	328
BsuRI	GGCC	1 cut(s)	30
BtsCI	GGATG	1 cut(s)	358
BtsIMutI	CAGTG	1 cut(s)	78
Cac8I	GCNNGC	2 cut(s)	21, 180
CaiI	CAGNNNCTG	1 cut(s)	388
Cfr13I	GGNCC	1 cut(s)	397
CsiI	ACCWGGT	1 cut(s)	144
CviAII	CATG	5 cut(s)	20, 85, 220, 282, 419
DdeI	CTNAG	1 cut(s)	32
DpnI	GATC	1 cut(s)	306
DpnII	GATC	1 cut(s)	304
DraI	TTTAAA	1 cut(s)	412
Eam1104I	CTCTTC	1 cut(s)	36
EarI	CTCTTC	1 cut(s)	36
EciI	GGCGGA	1 cut(s)	56
Eco24I	GRGCYC	1 cut(s)	219
Eco31I	GGTCTC	1 cut(s)	142
Eco32I	GATATC	1 cut(s)	93
Eco47I	GGWCC	1 cut(s)	397
EcoO109I	RGGNCCY	1 cut(s)	397
EcoRII	CCWGG	1 cut(s)	144
EcoRV	GATATC	1 cut(s)	93
EcoT38I	GRGCYC	1 cut(s)	219
FaeI	CATG	5 cut(s)	23, 88, 223, 285, 422
FatI	CATG	5 cut(s)	19, 84, 219, 281, 418
Fnu4HI	GCNGC	1 cut(s)	317
FokI	GGATG	1 cut(s)	365
FriOI	GRGCYC	1 cut(s)	219
Fsp4HI	GCNGC	1 cut(s)	317
FspBI	CTAG	2 cut(s)	24, 183
GluI	GCNGC	1 cut(s)	317
GsuI	CTGGAG	1 cut(s)	450
HaeIII	GGCC	1 cut(s)	30
Hin1II	CATG	5 cut(s)	23, 88, 223, 285, 422
Hpy166II	GTNNAC	1 cut(s)	151
Hpy188I	TCNGA	2 cut(s)	142, 384
Hpy188III	TCNNGA	2 cut(s)	212, 467
Hpy8I	GTNNAC	1 cut(s)	151
HpyAV	CCTTC	1 cut(s)	368
HpyCH4V	TGCA	1 cut(s)	266
HpyF10VI	GCNNNNNNNGC	1 cut(s)	179
HpyF3I	CTNAG	1 cut(s)	32
Hsp92II	CATG	5 cut(s)	23, 88, 223, 285, 422
Kzo9I	GATC	1 cut(s)	304
LguI	GCTCTTC	1 cut(s)	36
LmnI	GCTCC	1 cut(s)	16
LpnPI	CCDG	8 cut(s)	37, 66, 131, 158, 220, 282, 374, 380
Lsp1109I	GCAGC	1 cut(s)	328
LweI	GCATC	1 cut(s)	439
MabI	ACCWGGT	1 cut(s)	144
MaeI	CTAG	2 cut(s)	24, 183
MalI	GATC	1 cut(s)	306
MboI	GATC	1 cut(s)	304
MboII	GAAGA	3 cut(s)	53, 470, 482
MhlI	GDGCHC	1 cut(s)	219
MluCI	AATT	4 cut(s)	116, 160, 197, 437
MmeI	TCCRAC	1 cut(s)	165
MnlI	CCTC	3 cut(s)	41, 124, 131
MseI	TTAA	2 cut(s)	200, 411
MslI	CAYNNNNRTG	3 cut(s)	24, 83, 224
MspR9I	CCNGG	1 cut(s)	146
MvaI	CCWGG	1 cut(s)	146
MwoI	GCNNNNNNNGC	1 cut(s)	179
NdeII	GATC	1 cut(s)	304
NlaIII	CATG	5 cut(s)	23, 88, 223, 285, 422
NspI	RCATGY	2 cut(s)	23, 422
PaeI	GCATGC	1 cut(s)	23
PciSI	GCTCTTC	1 cut(s)	36
PkrI	GCNGC	1 cut(s)	318
PpuMI	RGGWCCY	1 cut(s)	397
PshBI	ATTAAT	1 cut(s)	200
Psp5II	RGGWCCY	1 cut(s)	397
Psp6I	CCWGG	1 cut(s)	144
PspGI	CCWGG	1 cut(s)	144
PspPI	GGNCC	1 cut(s)	397
PspPPI	RGGWCCY	1 cut(s)	397
PstNI	CAGNNNCTG	1 cut(s)	388
RseI	CAYNNNNRTG	3 cut(s)	24, 83, 224
SapI	GCTCTTC	1 cut(s)	36
SaqAI	TTAA	2 cut(s)	200, 411
SatI	GCNGC	1 cut(s)	317
Sau3AI	GATC	1 cut(s)	304
Sau96I	GGNCC	1 cut(s)	397
ScrFI	CCNGG	1 cut(s)	146
SduI	GDGCHC	1 cut(s)	219
SexAI	ACCWGGT	1 cut(s)	144
SfaNI	GCATC	1 cut(s)	439
SinI	GGWCC	1 cut(s)	397
SmiMI	CAYNNNNRTG	3 cut(s)	24, 83, 224
SmlI	CTYRAG	2 cut(s)	212, 401
SmoI	CTYRAG	2 cut(s)	212, 401
SphI	GCATGC	1 cut(s)	23
Sse9I	AATT	4 cut(s)	116, 160, 197, 437
SsiI	CCGC	1 cut(s)	67
SspMI	CTAG	2 cut(s)	24, 183
StyD4I	CCNGG	1 cut(s)	144
TaqI	TCGA	3 cut(s)	123, 341, 361
TasI	AATT	4 cut(s)	116, 160, 197, 437
Tru1I	TTAA	2 cut(s)	200, 411
Tru9I	TTAA	2 cut(s)	200, 411
TscAI	CASTG	1 cut(s)	85
TseI	GCWGC	1 cut(s)	316
TspDTI	ATGAA	3 cut(s)	153, 261, 270
TspGWI	ACGGA	1 cut(s)	143
TspRI	CASTG	1 cut(s)	85
VpaK11BI	GGWCC	1 cut(s)	397
VspI	ATTAAT	1 cut(s)	200
XapI	RAATTY	2 cut(s)	160, 437
XceI	RCATGY	2 cut(s)	23, 422
XspI	CTAG	2 cut(s)	24, 183

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.