Rroxscaffold_2G00124770

CRM domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
59205464 .. 59207921
2458 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00124770.1

Sequence Viewer

Length: 183 bp
ATGCAACATGTGGATTACCAAAAAGTGTCTTCTTTGCTTCAAGTCTTTGATTTCTGTGGCCTTCGAGCAGTGAGGAAGCACATTCTGAAGCTGGAACAAGACATTGAGTTGCTTAAAGCAGAGGCTAAAAGAAAAGTTGAATTTAGTTATGATGCTATTGAAGGAACTCCAGAAGATATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.99

Weight (kDa)

5.56

Isoelectric Point (pI)

56.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 107
AflIII ACRYGT 1 cut(s) 7
AgsI TTSAA 3 cut(s) 41, 140, 161
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
AoxI GGCC 1 cut(s) 58
ApoI RAATTY 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 21
BmsI GCATC 1 cut(s) 142
BpiI GAAGAC 1 cut(s) 21
BpmI CTGGAG 1 cut(s) 153
BshFI GGCC 1 cut(s) 60
BsnI GGCC 1 cut(s) 60
BspANI GGCC 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 11
BstV2I GAAGAC 1 cut(s) 21
BsuRI GGCC 1 cut(s) 60
BtsI GCAGTG 1 cut(s) 75
BtsIMutI CAGTG 1 cut(s) 75
CviAII CATG 1 cut(s) 8
CviJI RGCY 3 cut(s) 60, 91, 125
CviKI_1 RGCY 3 cut(s) 60, 91, 125
Eco57I CTGAAG 1 cut(s) 107
FaeI CATG 1 cut(s) 11
FaiI YATR 2 cut(s) 9, 150
FatI CATG 1 cut(s) 7
FspEI CC 7 cut(s) 32, 42, 58, 74, 77, 107, 147
GsuI CTGGAG 1 cut(s) 153
HaeIII GGCC 1 cut(s) 60
Hin1II CATG 1 cut(s) 11
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 170
HpyAV CCTTC 2 cut(s) 71, 155
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 11
LpnPI CCDG 1 cut(s) 77
LweI GCATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 21
MluCI AATT 1 cut(s) 140
MnlI CCTC 2 cut(s) 66, 115
MseI TTAA 1 cut(s) 114
NlaIII CATG 1 cut(s) 11
NspI RCATGY 1 cut(s) 11
PciI ACATGT 1 cut(s) 7
PscI ACATGT 1 cut(s) 7
SaqAI TTAA 1 cut(s) 114
SetI ASST 1 cut(s) 93
SfaNI GCATC 1 cut(s) 142
SgeI CNNG 5 cut(s) 20, 53, 77, 104, 110
Sse9I AATT 1 cut(s) 140
TaqI TCGA 1 cut(s) 64
TasI AATT 1 cut(s) 140
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TscAI CASTG 1 cut(s) 75
TspRI CASTG 1 cut(s) 75
XapI RAATTY 1 cut(s) 140
XceI RCATGY 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.