Rh2DG229300

Belongs to the AAA ATPase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
22676501 .. 22687447
10947 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG229300.1

Sequence Viewer

Length: 282 bp
ATGGTGATGGTGGACAACAGAAATTCATCAGTAGCCAAGCGTGCTAGAACCAACGGAAAAAACTCCACCACAGAACTAAGATTGAGGGAAGATAGCGCACAAACTTCATCTATAGAGAAATTAATAACCAGTCTTGAGCCCATGGGAGTGAGAGTTTATGAAGTTGATGAACCCAATGTGAGTTCTGCAATCAAAGATATTTCATGGGATAATCTTGCTGGATATGATCTACAAAAGCATGTATGCATGTCAAACCCTATTGTCAAGGTCGTTGAGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.36

Weight (kDa)

5.77

Isoelectric Point (pI)

41.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 22
ApoI RAATTY 1 cut(s) 22
AseI ATTAAT 1 cut(s) 122
AspLEI GCGC 1 cut(s) 98
AsuHPI GGTGA 1 cut(s) 16
BanII GRGCYC 1 cut(s) 141
BfaI CTAG 1 cut(s) 45
BfmI CTRYAG 1 cut(s) 111
BpuEI CTTGAG 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 141
BsaXI ACNNNNNCTCC 2 cut(s) 138, 168
Bse1I ACTGG 1 cut(s) 129
BseDI CCNNGG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 129
Bsp1286I GDGCHC 1 cut(s) 141
Bsp143I GATC 1 cut(s) 226
Bsp19I CCATGG 1 cut(s) 141
BsrI ACTGG 1 cut(s) 129
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 1 cut(s) 226
BssT1I CCWWGG 1 cut(s) 141
BstC8I GCNNGC 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 77
BstDSI CCRYGG 1 cut(s) 141
BstHHI GCGC 1 cut(s) 98
BstKTI GATC 1 cut(s) 229
BstMBI GATC 1 cut(s) 226
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstNSI RCATGY 2 cut(s) 242, 250
BstSFI CTRYAG 1 cut(s) 111
BtgI CCRYGG 1 cut(s) 141
Cac8I GCNNGC 1 cut(s) 42
CfoI GCGC 1 cut(s) 98
CviAII CATG 5 cut(s) 142, 204, 239, 247, 279
CviJI RGCY 3 cut(s) 35, 139, 277
CviKI_1 RGCY 3 cut(s) 35, 139, 277
DdeI CTNAG 1 cut(s) 77
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
Eco130I CCWWGG 1 cut(s) 141
Eco24I GRGCYC 1 cut(s) 141
EcoT14I CCWWGG 1 cut(s) 141
EcoT22I ATGCAT 1 cut(s) 248
EcoT38I GRGCYC 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 5 cut(s) 145, 207, 242, 250, 282
FaiI YATR 9 cut(s) 113, 143, 159, 205, 225, 240, 244, 248, 280
FatI CATG 5 cut(s) 141, 203, 238, 246, 278
FriOI GRGCYC 1 cut(s) 141
FspBI CTAG 1 cut(s) 45
GlaI GCGC 1 cut(s) 97
HhaI GCGC 1 cut(s) 98
Hin1II CATG 5 cut(s) 145, 207, 242, 250, 282
Hin6I GCGC 1 cut(s) 96
HinP1I GCGC 1 cut(s) 96
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 13
Hpy188III TCNNGA 1 cut(s) 134
Hpy8I GTNNAC 1 cut(s) 13
HpyCH4V TGCA 2 cut(s) 188, 246
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
HpyF3I CTNAG 1 cut(s) 77
Hsp92II CATG 5 cut(s) 145, 207, 242, 250, 282
HspAI GCGC 1 cut(s) 96
Kzo9I GATC 1 cut(s) 226
LpnPI CCDG 2 cut(s) 142, 204
MaeI CTAG 1 cut(s) 45
MalI GATC 1 cut(s) 228
MboI GATC 1 cut(s) 226
MboII GAAGA 1 cut(s) 101
MhlI GDGCHC 1 cut(s) 141
MluCI AATT 2 cut(s) 22, 119
MnlI CCTC 1 cut(s) 78
Mph1103I ATGCAT 1 cut(s) 248
MseI TTAA 1 cut(s) 122
MslI CAYNNNNRTG 1 cut(s) 146
MwoI GCNNNNNNNGC 1 cut(s) 41
NcoI CCATGG 1 cut(s) 141
NdeII GATC 1 cut(s) 226
NlaIII CATG 5 cut(s) 145, 207, 242, 250, 282
NsiI ATGCAT 1 cut(s) 248
NspI RCATGY 2 cut(s) 242, 250
PshBI ATTAAT 1 cut(s) 122
RseI CAYNNNNRTG 1 cut(s) 146
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 1 cut(s) 226
SduI GDGCHC 1 cut(s) 141
SetI ASST 1 cut(s) 270
SfcI CTRYAG 1 cut(s) 111
SmiMI CAYNNNNRTG 1 cut(s) 146
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 2 cut(s) 22, 119
SspMI CTAG 1 cut(s) 45
StyI CCWWGG 1 cut(s) 141
TasI AATT 2 cut(s) 22, 119
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TspDTI ATGAA 5 cut(s) 15, 96, 174, 183, 192
TspGWI ACGGA 1 cut(s) 69
VspI ATTAAT 1 cut(s) 122
XapI RAATTY 1 cut(s) 22
XceI RCATGY 2 cut(s) 242, 250
XspI CTAG 1 cut(s) 45
Zsp2I ATGCAT 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.