Rh6AG258300

Ubiquitin-2 like Rad60 SUMO-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
44984982 .. 44987650
2669 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG258300.1

Sequence Viewer

Length: 153 bp
ATGGCAGATTTTACCAAAGAACTCAAACCCCTTTTCAATTACAATCGCGTACAGCCTCTTAATGTCATCTCCTTTGACGACGACGACGAGGATGAGGCGTCTGTTTCTCCTCTGACCAAGAAGAGGAAGAAGGCTTCGAATTCAGTAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.7

Weight (kDa)

5.13

Isoelectric Point (pI)

31.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 48
AcsI RAATTY 1 cut(s) 139
AcyI GRCGYC 1 cut(s) 98
AfaI GTAC 1 cut(s) 51
AfiI CCNNNNNNNGG 1 cut(s) 123
AgsI TTSAA 1 cut(s) 37
ApoI RAATTY 1 cut(s) 139
AsuII TTCGAA 1 cut(s) 137
Bpu14I TTCGAA 1 cut(s) 137
BsaHI GRCGYC 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 123
BseGI GGATG 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 123
BseRI GAGGAG 1 cut(s) 99
Bsh1236I CGCG 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 123
Bsp119I TTCGAA 1 cut(s) 137
BspFNI CGCG 1 cut(s) 48
BspT104I TTCGAA 1 cut(s) 137
BssNI GRCGYC 1 cut(s) 98
Bst6I CTCTTC 1 cut(s) 116
BstACI GRCGYC 1 cut(s) 98
BstBI TTCGAA 1 cut(s) 137
BstF5I GGATG 1 cut(s) 97
BstFNI CGCG 1 cut(s) 48
BstUI CGCG 1 cut(s) 48
BtsCI GGATG 1 cut(s) 97
CseI GACGC 1 cut(s) 87
Csp6I GTAC 1 cut(s) 50
CviJI RGCY 2 cut(s) 55, 134
CviKI_1 RGCY 2 cut(s) 55, 134
CviQI GTAC 1 cut(s) 50
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
EcoRI GAATTC 1 cut(s) 139
FokI GGATG 1 cut(s) 104
HgaI GACGC 1 cut(s) 87
Hin1I GRCGYC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 114
Hpy99I CGWCG 3 cut(s) 83, 86, 89
HpyAV CCTTC 1 cut(s) 124
Hsp92I GRCGYC 1 cut(s) 98
MboII GAAGA 2 cut(s) 133, 139
MluCI AATT 2 cut(s) 37, 139
MnlI CCTC 5 cut(s) 66, 82, 88, 117, 120
MseI TTAA 1 cut(s) 60
MvnI CGCG 1 cut(s) 48
NspV TTCGAA 1 cut(s) 137
PcsI WCGNNNNNNNCGW 1 cut(s) 84
RsaI GTAC 1 cut(s) 51
RsaNI GTAC 1 cut(s) 50
SaqAI TTAA 1 cut(s) 60
SfuI TTCGAA 1 cut(s) 137
SgeI CNNG 3 cut(s) 59, 100, 130
Sse9I AATT 2 cut(s) 37, 139
TaqI TCGA 1 cut(s) 137
TasI AATT 2 cut(s) 37, 139
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
XapI RAATTY 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.