RchiOBHm_Chr6g0282081

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
45434492 .. 45437967
3476 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25303

Sequence Viewer

Length: 504 bp
ATGCTGAAGGAAATGTCGAGAAAATTTTTTCCCCAAATTCAAACCATAACCTTTTCAATTTGTGATTACGGTTTCCGTAATTCAATTTTAGTCATTTATAGCTCTGATATGTGTGTTTCAGGCGTGTTCCGGCGCGATTCACTGCACTCTCTCCCACTTTCACAATGGCAGATTTTACCAAAGAACTCAAACCCCTTTTCGATTACAATTGCGTACAGCCTCTCAATGTCATCTCCTTTGACGACGACGACGGTGGATGAGGTGTCTGCTTCTCCTCCAACCAAGAAGAGGAAGAAGGCTTCAAATTCAGTAGTTGAAAAGGTTGATGACAGTGTGAAGTTTGGTTCTTGCTTAATCCGCCAAGAATCTAGTGCTTCACCTTGCTGGATACGACAATGTAAAGGATTGAGGTTGGCTACCTGCATCCAGGATAGTGGTGTCAAAGAAATCAAGCCCAAGAGGAGTACAATCATGGGTAAAACTAAGAAAGGCTATCAAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

167

Amino Acids

18.66

Weight (kDa)

9.72

Isoelectric Point (pI)

58.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 428
AccII CGCG 1 cut(s) 135
AciI CCGC 1 cut(s) 358
AcsI RAATTY 3 cut(s) 23, 36, 304
AcuI CTGAAG 1 cut(s) 26
AfaI GTAC 2 cut(s) 215, 466
AfiI CCNNNNNNNGG 1 cut(s) 288
AgsI TTSAA 5 cut(s) 41, 57, 84, 303, 317
AjnI CCWGG 1 cut(s) 426
AluBI AGCT 1 cut(s) 102
AluI AGCT 1 cut(s) 102
ApoI RAATTY 3 cut(s) 23, 36, 304
AspLEI GCGC 1 cut(s) 135
AsuHPI GGTGA 1 cut(s) 369
BciT130I CCWGG 1 cut(s) 428
BciVI GTATCC 1 cut(s) 381
BfaI CTAG 1 cut(s) 369
BfuAI ACCTGC 1 cut(s) 428
BfuI GTATCC 1 cut(s) 381
Bme1390I CCNGG 1 cut(s) 428
BmrFI CCNGG 1 cut(s) 428
BmsI GCATC 1 cut(s) 432
Bsc4I CCNNNNNNNGG 1 cut(s) 288
BseBI CCWGG 1 cut(s) 428
BseGI GGATG 2 cut(s) 262, 423
BseLI CCNNNNNNNGG 1 cut(s) 288
BseRI GAGGAG 2 cut(s) 264, 475
BsgI GTGCAG 1 cut(s) 128
Bsh1236I CGCG 1 cut(s) 135
BsiSI CCGG 1 cut(s) 130
BslI CCNNNNNNNGG 1 cut(s) 288
BspACI CCGC 1 cut(s) 358
BspFNI CGCG 1 cut(s) 135
BspMI ACCTGC 1 cut(s) 428
Bst2UI CCWGG 1 cut(s) 428
Bst4CI ACNGT 3 cut(s) 71, 253, 332
Bst6I CTCTTC 1 cut(s) 281
BstDEI CTNAG 1 cut(s) 483
BstF5I GGATG 2 cut(s) 262, 423
BstFNI CGCG 1 cut(s) 135
BstHHI GCGC 1 cut(s) 135
BstMWI GCNNNNNNNGC 1 cut(s) 357
BstNI CCWGG 1 cut(s) 428
BstSCI CCNGG 1 cut(s) 426
BstUI CGCG 1 cut(s) 135
BstXI CCANNNNNNTGG 1 cut(s) 434
BsuI GTATCC 1 cut(s) 381
BtsCI GGATG 2 cut(s) 262, 423
BtsI GCAGTG 1 cut(s) 140
BtsIMutI CAGTG 2 cut(s) 140, 337
BveI ACCTGC 1 cut(s) 428
CfoI GCGC 1 cut(s) 135
Csp6I GTAC 2 cut(s) 214, 465
CviAII CATG 2 cut(s) 472, 501
CviJI RGCY 6 cut(s) 102, 219, 299, 416, 454, 492
CviKI_1 RGCY 6 cut(s) 102, 219, 299, 416, 454, 492
CviQI GTAC 2 cut(s) 214, 465
DdeI CTNAG 1 cut(s) 483
Eam1104I CTCTTC 1 cut(s) 281
EarI CTCTTC 1 cut(s) 281
EciI GGCGGA 1 cut(s) 347
Eco57I CTGAAG 1 cut(s) 26
EcoRII CCWGG 1 cut(s) 426
FaeI CATG 2 cut(s) 475, 504
FaiI YATR 5 cut(s) 47, 99, 110, 473, 502
FatI CATG 2 cut(s) 471, 500
FokI GGATG 2 cut(s) 269, 410
FspBI CTAG 1 cut(s) 369
GlaI GCGC 1 cut(s) 134
HapII CCGG 1 cut(s) 130
HhaI GCGC 1 cut(s) 135
Hin1II CATG 2 cut(s) 475, 504
Hin6I GCGC 1 cut(s) 133
HinP1I GCGC 1 cut(s) 133
HinfI GANTC 2 cut(s) 137, 365
HpaII CCGG 1 cut(s) 130
HphI GGTGA 1 cut(s) 369
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 1 cut(s) 18
Hpy99I CGWCG 3 cut(s) 247, 250, 253
HpyAV CCTTC 1 cut(s) 289
HpyCH4III ACNGT 3 cut(s) 71, 253, 332
HpyCH4V TGCA 2 cut(s) 145, 423
HpyF10VI GCNNNNNNNGC 1 cut(s) 357
HpyF3I CTNAG 1 cut(s) 483
Hsp92II CATG 2 cut(s) 475, 504
HspAI GCGC 1 cut(s) 133
LpnPI CCDG 6 cut(s) 105, 143, 370, 413, 433, 440
LweI GCATC 1 cut(s) 432
MaeI CTAG 1 cut(s) 369
MboII GAAGA 2 cut(s) 298, 304
MfeI CAATTG 1 cut(s) 207
MluCI AATT 7 cut(s) 23, 36, 57, 79, 84, 207, 304
MmeI TCCRAC 1 cut(s) 302
MnlI CCTC 6 cut(s) 230, 253, 282, 285, 402, 453
MseI TTAA 1 cut(s) 353
MspI CCGG 1 cut(s) 130
MspR9I CCNGG 1 cut(s) 428
MunI CAATTG 1 cut(s) 207
MvaI CCWGG 1 cut(s) 428
MvnI CGCG 1 cut(s) 135
MwoI GCNNNNNNNGC 1 cut(s) 357
NlaIII CATG 2 cut(s) 475, 504
PfeI GAWTC 2 cut(s) 137, 365
PfoI TCCNGGA 1 cut(s) 426
Psp6I CCWGG 1 cut(s) 426
PspGI CCWGG 1 cut(s) 426
RsaI GTAC 2 cut(s) 215, 466
RsaNI GTAC 2 cut(s) 214, 465
SaqAI TTAA 1 cut(s) 353
ScrFI CCNGG 1 cut(s) 428
SetI ASST 7 cut(s) 53, 104, 264, 324, 382, 413, 422
SfaNI GCATC 1 cut(s) 432
Sse9I AATT 7 cut(s) 23, 36, 57, 79, 84, 207, 304
SsiI CCGC 1 cut(s) 358
SspMI CTAG 1 cut(s) 369
StyD4I CCNGG 1 cut(s) 426
TaaI ACNGT 3 cut(s) 71, 253, 332
TaqI TCGA 2 cut(s) 17, 200
TasI AATT 7 cut(s) 23, 36, 57, 79, 84, 207, 304
TatI WGTACW 1 cut(s) 464
TfiI GAWTC 2 cut(s) 137, 365
Tru1I TTAA 1 cut(s) 353
Tru9I TTAA 1 cut(s) 353
TscAI CASTG 2 cut(s) 147, 337
TspGWI ACGGA 1 cut(s) 65
TspRI CASTG 2 cut(s) 147, 337
XapI RAATTY 3 cut(s) 23, 36, 304
XcmI CCANNNNNNNNNTGG 1 cut(s) 162
XspI CTAG 1 cut(s) 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.